Incidental Mutation 'R0490:Ap4e1'
ID43424
Institutional Source Beutler Lab
Gene Symbol Ap4e1
Ensembl Gene ENSMUSG00000001998
Gene Nameadaptor-related protein complex AP-4, epsilon 1
Synonyms2310033A20Rik
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0490 (G1)
Quality Score193
Status Validated
Chromosome2
Chromosomal Location127008717-127067909 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127046186 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 404 (N404K)
Ref Sequence ENSEMBL: ENSMUSP00000002063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002063] [ENSMUST00000110394] [ENSMUST00000142740] [ENSMUST00000175663] [ENSMUST00000177372]
Predicted Effect probably damaging
Transcript: ENSMUST00000002063
AA Change: N404K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002063
Gene: ENSMUSG00000001998
AA Change: N404K

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 600 5.9e-90 PFAM
low complexity region 841 853 N/A INTRINSIC
AP4E_app_platf 1017 1120 4.2e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110394
SMART Domains Protein: ENSMUSP00000106024
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 392 2.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142740
Predicted Effect probably benign
Transcript: ENSMUST00000175663
SMART Domains Protein: ENSMUSP00000135599
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 355 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177372
SMART Domains Protein: ENSMUSP00000135449
Gene: ENSMUSG00000001998

DomainStartEndE-ValueType
Pfam:Adaptin_N 51 291 2.5e-47 PFAM
Meta Mutation Damage Score 0.8407 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adaptor complexes large subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Disruption of this gene may be associated with cerebral palsy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enlarged lateral ventricles, decreased corpus callosum size, decreased vertical activity, and female anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Fxn A G 19: 24,277,179 probably null Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Lpl A G 8: 68,896,691 R290G probably damaging Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Notch4 T A 17: 34,582,890 D1237E probably damaging Het
Olfr1373 A G 11: 52,144,666 I288T probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rita1 A T 5: 120,611,565 F28I probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Slc1a1 A G 19: 28,897,531 K170E probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Ap4e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ap4e1 APN 2 127028281 missense probably damaging 1.00
IGL00423:Ap4e1 APN 2 127028289 missense probably damaging 0.99
IGL00659:Ap4e1 APN 2 127063301 missense probably benign 0.30
IGL01155:Ap4e1 APN 2 127043445 missense probably damaging 1.00
IGL01672:Ap4e1 APN 2 127052189 missense probably damaging 1.00
IGL01866:Ap4e1 APN 2 127046910 missense possibly damaging 0.83
IGL01940:Ap4e1 APN 2 127043511 missense probably damaging 0.97
IGL02131:Ap4e1 APN 2 127061929 missense probably benign
IGL02207:Ap4e1 APN 2 127011816 missense probably damaging 1.00
IGL03394:Ap4e1 APN 2 127063397 missense probably benign 0.18
quickstep UTSW 2 127008902 critical splice donor site probably null
K7371:Ap4e1 UTSW 2 127066536 unclassified probably benign
R0090:Ap4e1 UTSW 2 127064985 missense possibly damaging 0.70
R0420:Ap4e1 UTSW 2 127049360 missense probably damaging 1.00
R0632:Ap4e1 UTSW 2 127049280 nonsense probably null
R0670:Ap4e1 UTSW 2 127011864 critical splice donor site probably null
R0698:Ap4e1 UTSW 2 127063363 missense probably benign 0.00
R1183:Ap4e1 UTSW 2 127014201 missense probably damaging 0.98
R1338:Ap4e1 UTSW 2 127046909 missense probably damaging 1.00
R1513:Ap4e1 UTSW 2 127061555 missense probably null 1.00
R1528:Ap4e1 UTSW 2 127011823 missense possibly damaging 0.50
R1994:Ap4e1 UTSW 2 127061547 missense probably benign 0.00
R2270:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R2271:Ap4e1 UTSW 2 127047163 critical splice donor site probably null
R3108:Ap4e1 UTSW 2 127056306 critical splice donor site probably null
R4019:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4020:Ap4e1 UTSW 2 127061926 missense probably benign 0.01
R4454:Ap4e1 UTSW 2 127047141 missense probably damaging 1.00
R4691:Ap4e1 UTSW 2 127061871 missense probably benign 0.08
R4767:Ap4e1 UTSW 2 127060438 missense probably benign
R4803:Ap4e1 UTSW 2 127049559 missense probably benign 0.20
R4804:Ap4e1 UTSW 2 127043758 critical splice donor site probably null
R5155:Ap4e1 UTSW 2 127063369 missense probably benign 0.02
R5157:Ap4e1 UTSW 2 127061695 missense probably benign 0.00
R5248:Ap4e1 UTSW 2 127064922 missense possibly damaging 0.95
R5363:Ap4e1 UTSW 2 127037864 splice site probably null
R5507:Ap4e1 UTSW 2 127008898 missense probably damaging 0.98
R5642:Ap4e1 UTSW 2 127064979 missense possibly damaging 0.67
R6122:Ap4e1 UTSW 2 127028160 splice site probably null
R6180:Ap4e1 UTSW 2 127066588 nonsense probably null
R6298:Ap4e1 UTSW 2 127047115 missense probably benign 0.00
R6329:Ap4e1 UTSW 2 127061716 missense probably benign 0.10
R6543:Ap4e1 UTSW 2 127066605 missense probably benign 0.03
R6954:Ap4e1 UTSW 2 127064951 missense probably benign 0.01
R7144:Ap4e1 UTSW 2 127011807 missense probably damaging 0.99
R7165:Ap4e1 UTSW 2 127063318 missense possibly damaging 0.48
R7348:Ap4e1 UTSW 2 127061976 missense probably damaging 0.96
R7348:Ap4e1 UTSW 2 127061977 missense possibly damaging 0.76
R7382:Ap4e1 UTSW 2 127008902 critical splice donor site probably null
R7571:Ap4e1 UTSW 2 127019336 missense probably damaging 1.00
R7768:Ap4e1 UTSW 2 127046934 missense probably damaging 1.00
X0060:Ap4e1 UTSW 2 127063410 missense probably benign 0.01
X0065:Ap4e1 UTSW 2 127061650 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAGCGTCCTGAAAGTCCATAC -3'
(R):5'- GATGGCAGAGTCCACTGAACCAAG -3'

Sequencing Primer
(F):5'- CAAAAGCAGAACACTTAGCTTCTTG -3'
(R):5'- AAACTACTTAATTGCTTGGTCCCTG -3'
Posted On2013-05-23