Incidental Mutation 'R5480:Strc'
ID434246
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Namestereocilin
SynonymsDFNB16
MMRRC Submission 043041-MU
Accession Numbers

Genbank: NM_080459; MGI: 2153816

Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121363728-121387168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 121364819 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1661 (P1661Q)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000125812] [ENSMUST00000126130] [ENSMUST00000128612] [ENSMUST00000129130] [ENSMUST00000129136] [ENSMUST00000150271]
Predicted Effect probably benign
Transcript: ENSMUST00000000317
SMART Domains Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 58 133 5.8e-34 PFAM
Pfam:ATP-gua_Ptrans 154 401 4.5e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038389
AA Change: P1661Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: P1661Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078222
SMART Domains Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 1.2e-37 PFAM
Pfam:ATP-gua_Ptrans 154 401 2e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125812
SMART Domains Protein: ENSMUSP00000115501
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 9.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126130
SMART Domains Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128612
SMART Domains Protein: ENSMUSP00000115610
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 47 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129130
SMART Domains Protein: ENSMUSP00000123130
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 86 165 5.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145380
Predicted Effect probably benign
Transcript: ENSMUST00000150271
SMART Domains Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
Pfam:ATP-gua_PtransN 55 134 3.3e-38 PFAM
Pfam:ATP-gua_Ptrans 154 251 3.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153040
Meta Mutation Damage Score 0.1236 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121365060 missense probably benign 0.39
IGL01152:Strc APN 2 121370795 missense probably benign
IGL01608:Strc APN 2 121375594 missense probably benign 0.05
IGL01695:Strc APN 2 121375298 missense probably damaging 1.00
IGL01715:Strc APN 2 121365737 unclassified probably null
IGL01906:Strc APN 2 121377634 missense probably benign
IGL02135:Strc APN 2 121364834 missense probably damaging 1.00
IGL02416:Strc APN 2 121369058 missense probably damaging 1.00
IGL02455:Strc APN 2 121375791 unclassified probably benign
IGL03029:Strc APN 2 121364044 missense possibly damaging 0.95
IGL03176:Strc APN 2 121372180 missense probably damaging 0.99
IGL03272:Strc APN 2 121371751 missense probably damaging 1.00
3-1:Strc UTSW 2 121373680 missense probably damaging 0.99
IGL02799:Strc UTSW 2 121379236 missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121375307 missense probably damaging 1.00
R0022:Strc UTSW 2 121368393 missense probably damaging 1.00
R0494:Strc UTSW 2 121379533 missense probably damaging 0.99
R1065:Strc UTSW 2 121366651 missense probably damaging 1.00
R1148:Strc UTSW 2 121372077 intron probably benign
R1148:Strc UTSW 2 121372077 intron probably benign
R1203:Strc UTSW 2 121372123 missense possibly damaging 0.66
R1343:Strc UTSW 2 121365115 missense probably benign 0.21
R1544:Strc UTSW 2 121372738 splice site probably null
R1650:Strc UTSW 2 121380885 start gained probably benign
R1840:Strc UTSW 2 121379296 missense probably damaging 1.00
R1983:Strc UTSW 2 121371037 missense possibly damaging 0.54
R2035:Strc UTSW 2 121374934 missense probably damaging 1.00
R2058:Strc UTSW 2 121378887 missense probably damaging 1.00
R2158:Strc UTSW 2 121365862 missense probably benign 0.10
R2219:Strc UTSW 2 121364523 missense probably damaging 1.00
R2680:Strc UTSW 2 121365111 missense probably damaging 0.99
R4375:Strc UTSW 2 121380823 missense unknown
R4563:Strc UTSW 2 121365805 missense probably benign 0.02
R4578:Strc UTSW 2 121378003 missense possibly damaging 0.94
R4607:Strc UTSW 2 121372945 missense probably benign 0.31
R4651:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4652:Strc UTSW 2 121374348 missense possibly damaging 0.67
R4790:Strc UTSW 2 121375594 missense probably benign 0.05
R5580:Strc UTSW 2 121375012 missense probably damaging 0.99
R5679:Strc UTSW 2 121368100 missense probably benign 0.03
R5703:Strc UTSW 2 121370814 missense probably benign
R5841:Strc UTSW 2 121365877 missense probably benign 0.29
R5917:Strc UTSW 2 121379309 missense probably benign
R5958:Strc UTSW 2 121376922 missense possibly damaging 0.56
R6320:Strc UTSW 2 121374958 missense probably benign 0.16
R6619:Strc UTSW 2 121368432 missense probably damaging 0.99
R6695:Strc UTSW 2 121377224 missense probably benign 0.35
R6970:Strc UTSW 2 121378014 missense probably benign 0.41
R7018:Strc UTSW 2 121369058 missense probably damaging 1.00
R7045:Strc UTSW 2 121370726 missense probably damaging 1.00
R7190:Strc UTSW 2 121369026 missense probably benign 0.14
R7283:Strc UTSW 2 121379452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAATGTGGAAGACAAACTCTGAC -3'
(R):5'- GGAGTTACAGCACATCAGCAG -3'

Sequencing Primer
(F):5'- TCTGACACCTAGTGACAAACTGTGG -3'
(R):5'- TTACAGCACATCAGCAGTTGGG -3'
Posted On2016-10-06