Mutagenetix > Incidental Mutation

Incidental Mutation 'R5480:Strc'

434246

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

043041-MU

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R5480 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 121364819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 1661 (P1661Q)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000317] [ENSMUST00000038389] [ENSMUST00000078222] [ENSMUST00000125812] [ENSMUST00000126130] [ENSMUST00000128612] [ENSMUST00000129130] [ENSMUST00000129136] [ENSMUST00000150271]

AlphaFold

Q8VIM6

Predicted Effect

probably benign
Transcript: ENSMUST00000000317

SMART Domains

Protein: ENSMUSP00000000317
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	58	133	5.8e-34	PFAM
Pfam:ATP-gua_Ptrans	154	401	4.5e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038389
AA Change: P1661Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: P1661Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000078222

SMART Domains

Protein: ENSMUSP00000077349
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	1.2e-37	PFAM
Pfam:ATP-gua_Ptrans	154	401	2e-105	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125812

SMART Domains

Protein: ENSMUSP00000115501
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	9.7e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126130

SMART Domains

Protein: ENSMUSP00000117463
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
low complexity region	39	54	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000128612

SMART Domains

Protein: ENSMUSP00000115610
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
low complexity region	47	63	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129130

SMART Domains

Protein: ENSMUSP00000123130
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	86	165	5.7e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145380

Predicted Effect

probably benign
Transcript: ENSMUST00000150271

SMART Domains

Protein: ENSMUSP00000120507
Gene: ENSMUSG00000000308

Domain	Start	End	E-Value	Type
low complexity region	6	32	N/A	INTRINSIC
Pfam:ATP-gua_PtransN	55	134	3.3e-38	PFAM
Pfam:ATP-gua_Ptrans	154	251	3.8e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153040

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.7%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,157,999	C2257*	probably null	Het
Alkbh7	A	G	17: 56,999,131		probably benign	Het
Alpk2	A	G	18: 65,349,908	L343S	probably damaging	Het
Btbd10	T	A	7: 113,316,707	R392W	probably damaging	Het
Camkv	A	G	9: 107,946,875	D216G	probably damaging	Het
Col22a1	T	C	15: 71,964,611	D525G	probably damaging	Het
Dqx1	A	T	6: 83,064,803	D542V	probably damaging	Het
Epha8	T	C	4: 136,935,130	T539A	probably benign	Het
Faap100	T	C	11: 120,377,113	E278G	probably damaging	Het
Fat2	A	G	11: 55,310,086	S721P	probably damaging	Het
Frem2	A	T	3: 53,656,507	L193*	probably null	Het
Gfy	C	A	7: 45,177,233	V394F	probably benign	Het
Gipr	A	G	7: 19,160,654	L241P	probably damaging	Het
Gm5478	A	G	15: 101,643,665	S445P	probably damaging	Het
Ift140	G	T	17: 25,020,576	W69L	probably damaging	Het
Kat6a	T	A	8: 22,938,307	M1226K	possibly damaging	Het
Klk12	T	G	7: 43,771,058	H140Q	probably benign	Het
Map3k14	A	G	11: 103,239,504	F196L	probably benign	Het
Mblac2	T	A	13: 81,750,276	V257E	possibly damaging	Het
Pcdha11	A	G	18: 37,005,882	E188G	probably benign	Het
Pdzd7	T	C	19: 45,039,285	N250S	possibly damaging	Het
Phkb	A	G	8: 85,922,182	D209G	probably damaging	Het
Pigs	T	G	11: 78,329,075	I92S	possibly damaging	Het
Pigz	G	T	16: 31,944,621	G166C	probably damaging	Het
Pkd1l2	C	A	8: 117,030,649	R1550L	probably damaging	Het
Pkd2l1	A	G	19: 44,192,156	V40A	probably benign	Het
Plxna1	A	T	6: 89,324,634	M1470K	probably damaging	Het
Polq	T	A	16: 37,013,290		probably benign	Het
Prune2	A	G	19: 17,120,947	T1272A	possibly damaging	Het
Rfwd3	A	T	8: 111,273,832	D720E	probably damaging	Het
Rgs12	C	G	5: 34,966,111	Q413E	probably benign	Het
Rhobtb1	T	A	10: 69,270,733	V376D	possibly damaging	Het
Rrp8	C	T	7: 105,734,129	S310N	probably damaging	Het
S100a3	C	T	3: 90,602,284	L79F	probably damaging	Het
Setbp1	C	A	18: 78,858,063	M796I	probably damaging	Het
Sipa1	A	G	19: 5,659,630	L254P	possibly damaging	Het
Slc4a7	C	G	14: 14,782,138	H964Q	probably damaging	Het
Taf5l	A	T	8: 124,009,820	V4E	possibly damaging	Het
Tbc1d15	T	C	10: 115,233,218	E82G	probably damaging	Het
Thada	A	G	17: 84,432,254	S858P	probably benign	Het
Ticrr	T	C	7: 79,660,809	V157A	probably damaging	Het
Trim21	T	C	7: 102,559,256	T419A	probably benign	Het
Vmn2r60	G	T	7: 42,135,730	W122L	probably damaging	Het
Vwa3b	C	A	1: 37,100,706	Y369*	probably null	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATGTGGAAGACAAACTCTGAC -3'
(R):5'- GGAGTTACAGCACATCAGCAG -3'

Sequencing Primer
(F):5'- TCTGACACCTAGTGACAAACTGTGG -3'
(R):5'- TTACAGCACATCAGCAGTTGGG -3'

Posted On

2016-10-06