Incidental Mutation 'R5480:Frem2'
ID 434249
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene Name Fras1 related extracellular matrix protein 2
Synonyms my, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 043041-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5480 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 53513938-53657355 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 53656507 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 193 (L193*)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000091137
AA Change: L193*
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: L193*

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 (GRCm38) C2257* probably null Het
Alkbh7 A G 17: 56,999,131 (GRCm38) probably benign Het
Alpk2 A G 18: 65,349,908 (GRCm38) L343S probably damaging Het
Btbd10 T A 7: 113,316,707 (GRCm38) R392W probably damaging Het
Camkv A G 9: 107,946,875 (GRCm38) D216G probably damaging Het
Col22a1 T C 15: 71,964,611 (GRCm38) D525G probably damaging Het
Dqx1 A T 6: 83,064,803 (GRCm38) D542V probably damaging Het
Epha8 T C 4: 136,935,130 (GRCm38) T539A probably benign Het
Faap100 T C 11: 120,377,113 (GRCm38) E278G probably damaging Het
Fat2 A G 11: 55,310,086 (GRCm38) S721P probably damaging Het
Gfy C A 7: 45,177,233 (GRCm38) V394F probably benign Het
Gipr A G 7: 19,160,654 (GRCm38) L241P probably damaging Het
Gm5478 A G 15: 101,643,665 (GRCm38) S445P probably damaging Het
Ift140 G T 17: 25,020,576 (GRCm38) W69L probably damaging Het
Kat6a T A 8: 22,938,307 (GRCm38) M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 (GRCm38) H140Q probably benign Het
Map3k14 A G 11: 103,239,504 (GRCm38) F196L probably benign Het
Mblac2 T A 13: 81,750,276 (GRCm38) V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 (GRCm38) E188G probably benign Het
Pdzd7 T C 19: 45,039,285 (GRCm38) N250S possibly damaging Het
Phkb A G 8: 85,922,182 (GRCm38) D209G probably damaging Het
Pigs T G 11: 78,329,075 (GRCm38) I92S possibly damaging Het
Pigz G T 16: 31,944,621 (GRCm38) G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 (GRCm38) R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 (GRCm38) V40A probably benign Het
Plxna1 A T 6: 89,324,634 (GRCm38) M1470K probably damaging Het
Polq T A 16: 37,013,290 (GRCm38) probably benign Het
Prune2 A G 19: 17,120,947 (GRCm38) T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 (GRCm38) D720E probably damaging Het
Rgs12 C G 5: 34,966,111 (GRCm38) Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 (GRCm38) V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 (GRCm38) S310N probably damaging Het
S100a3 C T 3: 90,602,284 (GRCm38) L79F probably damaging Het
Setbp1 C A 18: 78,858,063 (GRCm38) M796I probably damaging Het
Sipa1 A G 19: 5,659,630 (GRCm38) L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 (GRCm38) H964Q probably damaging Het
Strc G T 2: 121,364,819 (GRCm38) P1661Q probably benign Het
Taf5l A T 8: 124,009,820 (GRCm38) V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 (GRCm38) E82G probably damaging Het
Thada A G 17: 84,432,254 (GRCm38) S858P probably benign Het
Ticrr T C 7: 79,660,809 (GRCm38) V157A probably damaging Het
Trim21 T C 7: 102,559,256 (GRCm38) T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 (GRCm38) W122L probably damaging Het
Vwa3b C A 1: 37,100,706 (GRCm38) Y369* probably null Het
Ythdf3 T C 3: 16,183,500 (GRCm38) S2P possibly damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53,585,595 (GRCm38) missense probably damaging 1.00
IGL00911:Frem2 APN 3 53,572,462 (GRCm38) missense probably damaging 1.00
IGL01322:Frem2 APN 3 53,541,038 (GRCm38) missense probably benign 0.00
IGL01330:Frem2 APN 3 53,655,241 (GRCm38) missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53,525,896 (GRCm38) missense probably damaging 1.00
IGL01556:Frem2 APN 3 53,535,281 (GRCm38) missense probably benign 0.23
IGL01580:Frem2 APN 3 53,655,175 (GRCm38) missense probably damaging 1.00
IGL01606:Frem2 APN 3 53,653,591 (GRCm38) missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53,655,709 (GRCm38) missense probably benign 0.00
IGL01648:Frem2 APN 3 53,535,732 (GRCm38) missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53,517,013 (GRCm38) missense probably damaging 1.00
IGL01665:Frem2 APN 3 53,549,662 (GRCm38) missense probably benign 0.07
IGL01670:Frem2 APN 3 53,656,937 (GRCm38) missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53,522,304 (GRCm38) missense probably benign 0.33
IGL02175:Frem2 APN 3 53,655,599 (GRCm38) missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53,519,640 (GRCm38) missense probably benign 0.35
IGL02202:Frem2 APN 3 53,654,799 (GRCm38) missense probably benign 0.00
IGL02427:Frem2 APN 3 53,535,763 (GRCm38) missense probably damaging 0.97
IGL02457:Frem2 APN 3 53,521,049 (GRCm38) missense probably damaging 0.99
IGL02638:Frem2 APN 3 53,551,346 (GRCm38) missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53,652,175 (GRCm38) missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53,655,628 (GRCm38) missense probably benign 0.40
IGL03169:Frem2 APN 3 53,522,292 (GRCm38) missense probably benign 0.01
IGL03238:Frem2 APN 3 53,656,261 (GRCm38) missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53,572,308 (GRCm38) missense probably benign 0.01
IGL03273:Frem2 APN 3 53,537,509 (GRCm38) nonsense probably null
IGL03343:Frem2 APN 3 53,652,253 (GRCm38) missense probably damaging 1.00
Biosimilar UTSW 3 53,654,323 (GRCm38) missense probably benign 0.01
Fruit_stripe UTSW 3 53,537,489 (GRCm38) missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53,653,201 (GRCm38) missense probably damaging 0.98
R0019:Frem2 UTSW 3 53,523,678 (GRCm38) missense probably damaging 0.99
R0092:Frem2 UTSW 3 53,589,796 (GRCm38) missense probably benign 0.03
R0108:Frem2 UTSW 3 53,647,961 (GRCm38) missense probably benign 0.03
R0115:Frem2 UTSW 3 53,656,208 (GRCm38) missense probably damaging 0.99
R0118:Frem2 UTSW 3 53,535,243 (GRCm38) nonsense probably null
R0374:Frem2 UTSW 3 53,653,960 (GRCm38) missense probably damaging 1.00
R0437:Frem2 UTSW 3 53,653,015 (GRCm38) missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53,519,954 (GRCm38) missense probably damaging 1.00
R0555:Frem2 UTSW 3 53,516,860 (GRCm38) missense probably damaging 0.97
R0564:Frem2 UTSW 3 53,656,109 (GRCm38) missense probably damaging 0.97
R0586:Frem2 UTSW 3 53,647,921 (GRCm38) missense probably damaging 0.99
R0726:Frem2 UTSW 3 53,519,626 (GRCm38) missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53,653,973 (GRCm38) missense probably benign
R1233:Frem2 UTSW 3 53,547,778 (GRCm38) missense probably damaging 0.98
R1302:Frem2 UTSW 3 53,655,538 (GRCm38) missense probably benign 0.00
R1333:Frem2 UTSW 3 53,549,731 (GRCm38) missense probably benign 0.26
R1446:Frem2 UTSW 3 53,654,596 (GRCm38) missense probably benign 0.31
R1523:Frem2 UTSW 3 53,655,407 (GRCm38) missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53,654,210 (GRCm38) missense probably benign 0.19
R1543:Frem2 UTSW 3 53,572,455 (GRCm38) missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53,654,519 (GRCm38) missense probably benign 0.19
R1600:Frem2 UTSW 3 53,547,723 (GRCm38) missense probably damaging 1.00
R1678:Frem2 UTSW 3 53,519,938 (GRCm38) missense probably damaging 1.00
R1687:Frem2 UTSW 3 53,653,952 (GRCm38) missense probably benign
R1696:Frem2 UTSW 3 53,656,042 (GRCm38) nonsense probably null
R1758:Frem2 UTSW 3 53,653,357 (GRCm38) missense probably damaging 1.00
R1857:Frem2 UTSW 3 53,654,873 (GRCm38) missense probably benign 0.10
R1869:Frem2 UTSW 3 53,535,196 (GRCm38) missense probably benign 0.04
R1921:Frem2 UTSW 3 53,653,495 (GRCm38) missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53,652,232 (GRCm38) missense probably benign 0.01
R2045:Frem2 UTSW 3 53,535,744 (GRCm38) missense probably damaging 1.00
R2113:Frem2 UTSW 3 53,652,922 (GRCm38) missense probably damaging 1.00
R2152:Frem2 UTSW 3 53,517,029 (GRCm38) nonsense probably null
R2164:Frem2 UTSW 3 53,537,330 (GRCm38) missense probably damaging 1.00
R2181:Frem2 UTSW 3 53,574,587 (GRCm38) missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53,516,573 (GRCm38) missense probably benign
R2221:Frem2 UTSW 3 53,516,857 (GRCm38) missense probably benign 0.00
R2255:Frem2 UTSW 3 53,652,514 (GRCm38) missense probably damaging 0.96
R2280:Frem2 UTSW 3 53,572,423 (GRCm38) missense probably damaging 1.00
R3196:Frem2 UTSW 3 53,537,331 (GRCm38) missense probably damaging 1.00
R3716:Frem2 UTSW 3 53,572,360 (GRCm38) missense probably damaging 1.00
R3807:Frem2 UTSW 3 53,653,449 (GRCm38) missense probably benign 0.22
R3820:Frem2 UTSW 3 53,516,849 (GRCm38) missense probably damaging 1.00
R3821:Frem2 UTSW 3 53,652,415 (GRCm38) missense probably damaging 1.00
R3977:Frem2 UTSW 3 53,652,070 (GRCm38) missense probably benign 0.00
R3979:Frem2 UTSW 3 53,652,070 (GRCm38) missense probably benign 0.00
R4014:Frem2 UTSW 3 53,652,353 (GRCm38) missense probably benign 0.01
R4127:Frem2 UTSW 3 53,525,896 (GRCm38) missense probably damaging 1.00
R4195:Frem2 UTSW 3 53,539,268 (GRCm38) missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53,539,268 (GRCm38) missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53,545,502 (GRCm38) missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53,539,162 (GRCm38) critical splice donor site probably null
R4428:Frem2 UTSW 3 53,654,338 (GRCm38) missense probably benign 0.40
R4559:Frem2 UTSW 3 53,654,321 (GRCm38) missense probably benign 0.01
R4600:Frem2 UTSW 3 53,547,807 (GRCm38) missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53,547,807 (GRCm38) missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53,547,807 (GRCm38) missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53,547,807 (GRCm38) missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53,655,443 (GRCm38) missense probably damaging 1.00
R4678:Frem2 UTSW 3 53,544,371 (GRCm38) missense probably benign 0.00
R4689:Frem2 UTSW 3 53,547,635 (GRCm38) missense probably benign 0.43
R4740:Frem2 UTSW 3 53,535,819 (GRCm38) missense probably benign 0.04
R4748:Frem2 UTSW 3 53,541,093 (GRCm38) missense probably damaging 1.00
R4790:Frem2 UTSW 3 53,516,741 (GRCm38) missense probably benign
R4809:Frem2 UTSW 3 53,653,895 (GRCm38) missense probably benign 0.01
R4930:Frem2 UTSW 3 53,656,315 (GRCm38) missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53,539,183 (GRCm38) missense probably damaging 1.00
R5057:Frem2 UTSW 3 53,535,196 (GRCm38) missense probably benign 0.37
R5202:Frem2 UTSW 3 53,551,346 (GRCm38) missense probably benign 0.41
R5221:Frem2 UTSW 3 53,585,611 (GRCm38) missense probably damaging 1.00
R5231:Frem2 UTSW 3 53,522,295 (GRCm38) missense probably damaging 1.00
R5268:Frem2 UTSW 3 53,653,154 (GRCm38) missense probably damaging 0.96
R5637:Frem2 UTSW 3 53,652,937 (GRCm38) missense probably damaging 0.97
R5664:Frem2 UTSW 3 53,652,490 (GRCm38) missense probably benign 0.33
R5698:Frem2 UTSW 3 53,652,505 (GRCm38) missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53,655,959 (GRCm38) missense probably damaging 1.00
R5754:Frem2 UTSW 3 53,537,258 (GRCm38) missense probably damaging 1.00
R5808:Frem2 UTSW 3 53,652,563 (GRCm38) missense probably damaging 0.96
R5840:Frem2 UTSW 3 53,647,921 (GRCm38) missense probably damaging 0.99
R5874:Frem2 UTSW 3 53,537,489 (GRCm38) missense probably benign 0.21
R6050:Frem2 UTSW 3 53,653,012 (GRCm38) missense probably damaging 0.99
R6103:Frem2 UTSW 3 53,549,788 (GRCm38) missense probably benign 0.00
R6149:Frem2 UTSW 3 53,551,341 (GRCm38) missense probably damaging 0.98
R6182:Frem2 UTSW 3 53,647,969 (GRCm38) missense probably damaging 1.00
R6191:Frem2 UTSW 3 53,655,280 (GRCm38) missense probably benign 0.10
R6245:Frem2 UTSW 3 53,655,824 (GRCm38) missense probably benign 0.00
R6252:Frem2 UTSW 3 53,572,448 (GRCm38) missense probably damaging 1.00
R6393:Frem2 UTSW 3 53,585,640 (GRCm38) missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53,572,378 (GRCm38) missense probably benign 0.01
R6595:Frem2 UTSW 3 53,549,784 (GRCm38) missense probably damaging 1.00
R6665:Frem2 UTSW 3 53,654,656 (GRCm38) missense probably damaging 1.00
R6708:Frem2 UTSW 3 53,585,501 (GRCm38) missense probably benign 0.00
R6751:Frem2 UTSW 3 53,653,665 (GRCm38) missense probably damaging 1.00
R6787:Frem2 UTSW 3 53,654,323 (GRCm38) missense probably benign 0.01
R6913:Frem2 UTSW 3 53,516,821 (GRCm38) missense probably damaging 1.00
R6916:Frem2 UTSW 3 53,547,688 (GRCm38) missense probably damaging 1.00
R7017:Frem2 UTSW 3 53,519,602 (GRCm38) missense probably benign 0.02
R7083:Frem2 UTSW 3 53,537,493 (GRCm38) missense probably damaging 0.99
R7108:Frem2 UTSW 3 53,653,513 (GRCm38) missense probably damaging 1.00
R7133:Frem2 UTSW 3 53,572,339 (GRCm38) missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53,654,753 (GRCm38) missense probably damaging 1.00
R7341:Frem2 UTSW 3 53,654,495 (GRCm38) missense probably damaging 1.00
R7455:Frem2 UTSW 3 53,572,280 (GRCm38) splice site probably null
R7487:Frem2 UTSW 3 53,654,549 (GRCm38) missense probably benign 0.40
R7495:Frem2 UTSW 3 53,516,837 (GRCm38) missense probably benign 0.13
R7542:Frem2 UTSW 3 53,652,579 (GRCm38) missense probably damaging 1.00
R7636:Frem2 UTSW 3 53,653,247 (GRCm38) missense probably benign 0.00
R7703:Frem2 UTSW 3 53,522,168 (GRCm38) missense probably benign 0.01
R7750:Frem2 UTSW 3 53,523,682 (GRCm38) missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53,572,374 (GRCm38) missense probably damaging 1.00
R7922:Frem2 UTSW 3 53,653,304 (GRCm38) missense probably damaging 0.98
R8008:Frem2 UTSW 3 53,652,910 (GRCm38) missense probably damaging 1.00
R8051:Frem2 UTSW 3 53,535,355 (GRCm38) missense probably benign 0.04
R8052:Frem2 UTSW 3 53,549,643 (GRCm38) missense probably benign 0.02
R8176:Frem2 UTSW 3 53,655,340 (GRCm38) missense possibly damaging 0.50
R8220:Frem2 UTSW 3 53,656,507 (GRCm38) nonsense probably null
R8397:Frem2 UTSW 3 53,653,141 (GRCm38) missense probably benign 0.00
R8410:Frem2 UTSW 3 53,539,177 (GRCm38) missense possibly damaging 0.60
R8697:Frem2 UTSW 3 53,525,828 (GRCm38) missense probably damaging 0.99
R9134:Frem2 UTSW 3 53,654,900 (GRCm38) missense probably damaging 1.00
R9183:Frem2 UTSW 3 53,520,065 (GRCm38) missense probably damaging 1.00
R9260:Frem2 UTSW 3 53,652,783 (GRCm38) missense probably damaging 1.00
R9267:Frem2 UTSW 3 53,657,083 (GRCm38) start codon destroyed probably null 0.00
R9299:Frem2 UTSW 3 53,656,559 (GRCm38) missense probably benign 0.37
R9378:Frem2 UTSW 3 53,651,989 (GRCm38) missense probably damaging 0.99
R9444:Frem2 UTSW 3 53,652,844 (GRCm38) missense probably benign 0.10
R9459:Frem2 UTSW 3 53,653,486 (GRCm38) missense probably benign
R9487:Frem2 UTSW 3 53,653,484 (GRCm38) missense possibly damaging 0.95
R9728:Frem2 UTSW 3 53,656,631 (GRCm38) missense probably benign 0.00
R9759:Frem2 UTSW 3 53,655,497 (GRCm38) missense possibly damaging 0.76
Z1177:Frem2 UTSW 3 53,655,607 (GRCm38) missense probably benign 0.31
Z1177:Frem2 UTSW 3 53,535,166 (GRCm38) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGTCCATCAAAAGGGTC -3'
(R):5'- TTGAGTCCCAAGCGTTTTGC -3'

Sequencing Primer
(F):5'- TCAAAAGGGTCTTAGAGGTCCCTC -3'
(R):5'- TTGCGTGCGACTATGGCC -3'
Posted On 2016-10-06