Incidental Mutation 'R5480:Vmn2r60'
ID434258
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42135730 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 122 (W122L)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably damaging
Transcript: ENSMUST00000166447
AA Change: W122L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: W122L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Sipa1 A G 19: 5,659,630 L254P possibly damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7296:Vmn2r60 UTSW 7 42136402 missense probably benign 0.01
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7527:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7529:Vmn2r60 UTSW 7 42195734 frame shift probably null
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCACTGCGCTAAATAGAAAAGTTG -3'
(R):5'- AGGGTACTTGTTTCCTAGGTCC -3'

Sequencing Primer
(F):5'- AGAAAAGTTGTATGGTCTATGGCTTC -3'
(R):5'- GGTACTTGTTTCCTAGGTCCTACATC -3'
Posted On2016-10-06