Mutagenetix > Incidental Mutations

Incidental Mutation 'R5480:Ift140'

434284

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

043041-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5480 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 25020576 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 69 (W69L)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

Predicted Effect

probably damaging
Transcript: ENSMUST00000024983
AA Change: W69L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: W69L

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000137386
AA Change: W69L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: W69L

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151776

Meta Mutation Damage Score

0.9683

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.7%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,157,999	C2257*	probably null	Het
Alkbh7	A	G	17: 56,999,131		probably benign	Het
Alpk2	A	G	18: 65,349,908	L343S	probably damaging	Het
Btbd10	T	A	7: 113,316,707	R392W	probably damaging	Het
Camkv	A	G	9: 107,946,875	D216G	probably damaging	Het
Col22a1	T	C	15: 71,964,611	D525G	probably damaging	Het
Dqx1	A	T	6: 83,064,803	D542V	probably damaging	Het
Epha8	T	C	4: 136,935,130	T539A	probably benign	Het
Faap100	T	C	11: 120,377,113	E278G	probably damaging	Het
Fat2	A	G	11: 55,310,086	S721P	probably damaging	Het
Frem2	A	T	3: 53,656,507	L193*	probably null	Het
Gfy	C	A	7: 45,177,233	V394F	probably benign	Het
Gipr	A	G	7: 19,160,654	L241P	probably damaging	Het
Gm5478	A	G	15: 101,643,665	S445P	probably damaging	Het
Kat6a	T	A	8: 22,938,307	M1226K	possibly damaging	Het
Klk12	T	G	7: 43,771,058	H140Q	probably benign	Het
Map3k14	A	G	11: 103,239,504	F196L	probably benign	Het
Mblac2	T	A	13: 81,750,276	V257E	possibly damaging	Het
Pcdha11	A	G	18: 37,005,882	E188G	probably benign	Het
Pdzd7	T	C	19: 45,039,285	N250S	possibly damaging	Het
Phkb	A	G	8: 85,922,182	D209G	probably damaging	Het
Pigs	T	G	11: 78,329,075	I92S	possibly damaging	Het
Pigz	G	T	16: 31,944,621	G166C	probably damaging	Het
Pkd1l2	C	A	8: 117,030,649	R1550L	probably damaging	Het
Pkd2l1	A	G	19: 44,192,156	V40A	probably benign	Het
Plxna1	A	T	6: 89,324,634	M1470K	probably damaging	Het
Polq	T	A	16: 37,013,290		probably benign	Het
Prune2	A	G	19: 17,120,947	T1272A	possibly damaging	Het
Rfwd3	A	T	8: 111,273,832	D720E	probably damaging	Het
Rgs12	C	G	5: 34,966,111	Q413E	probably benign	Het
Rhobtb1	T	A	10: 69,270,733	V376D	possibly damaging	Het
Rrp8	C	T	7: 105,734,129	S310N	probably damaging	Het
S100a3	C	T	3: 90,602,284	L79F	probably damaging	Het
Setbp1	C	A	18: 78,858,063	M796I	probably damaging	Het
Sipa1	A	G	19: 5,659,630	L254P	possibly damaging	Het
Slc4a7	C	G	14: 14,782,138	H964Q	probably damaging	Het
Strc	G	T	2: 121,364,819	P1661Q	probably benign	Het
Taf5l	A	T	8: 124,009,820	V4E	possibly damaging	Het
Tbc1d15	T	C	10: 115,233,218	E82G	probably damaging	Het
Thada	A	G	17: 84,432,254	S858P	probably benign	Het
Ticrr	T	C	7: 79,660,809	V157A	probably damaging	Het
Trim21	T	C	7: 102,559,256	T419A	probably benign	Het
Vmn2r60	G	T	7: 42,135,730	W122L	probably damaging	Het
Vwa3b	C	A	1: 37,100,706	Y369*	probably null	Het
Ythdf3	T	C	3: 16,183,500	S2P	possibly damaging	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTGGAAGATACCCATCATTAGCC -3'
(R):5'- ACATGCATCCTATGTGCACG -3'

Sequencing Primer
(F):5'- CTCAAGTATCCACACGCATGTTG -3'
(R):5'- CATCCTATGTGCACGGTGGG -3'

Posted On

2016-10-06