Incidental Mutation 'R5480:Sipa1'
ID434290
Institutional Source Beutler Lab
Gene Symbol Sipa1
Ensembl Gene ENSMUSG00000056917
Gene Namesignal-induced proliferation associated gene 1
SynonymsSPA-1
MMRRC Submission 043041-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5480 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5651185-5663707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5659630 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 254 (L254P)
Ref Sequence ENSEMBL: ENSMUSP00000132345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000164304] [ENSMUST00000169854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071857
AA Change: L254P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917
AA Change: L254P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080824
AA Change: L254P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917
AA Change: L254P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164304
AA Change: L254P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917
AA Change: L254P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169854
AA Change: L254P

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917
AA Change: L254P

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.0814 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a mitogen induced GTPase activating protein (GAP). It exhibits a specific GAP activity for Ras-related regulatory proteins Rap1 and Rap2, but not for Ran or other small GTPases. This protein may also hamper mitogen-induced cell cycle progression when abnormally or prematurely expressed. It is localized to the perinuclear region. Two alternatively spliced variants encoding the same isoform have been characterized to date. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display chronic myelocytic leukemia in either the chronic phase or blast crisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,157,999 C2257* probably null Het
Alkbh7 A G 17: 56,999,131 probably benign Het
Alpk2 A G 18: 65,349,908 L343S probably damaging Het
Btbd10 T A 7: 113,316,707 R392W probably damaging Het
Camkv A G 9: 107,946,875 D216G probably damaging Het
Col22a1 T C 15: 71,964,611 D525G probably damaging Het
Dqx1 A T 6: 83,064,803 D542V probably damaging Het
Epha8 T C 4: 136,935,130 T539A probably benign Het
Faap100 T C 11: 120,377,113 E278G probably damaging Het
Fat2 A G 11: 55,310,086 S721P probably damaging Het
Frem2 A T 3: 53,656,507 L193* probably null Het
Gfy C A 7: 45,177,233 V394F probably benign Het
Gipr A G 7: 19,160,654 L241P probably damaging Het
Gm5478 A G 15: 101,643,665 S445P probably damaging Het
Ift140 G T 17: 25,020,576 W69L probably damaging Het
Kat6a T A 8: 22,938,307 M1226K possibly damaging Het
Klk12 T G 7: 43,771,058 H140Q probably benign Het
Map3k14 A G 11: 103,239,504 F196L probably benign Het
Mblac2 T A 13: 81,750,276 V257E possibly damaging Het
Pcdha11 A G 18: 37,005,882 E188G probably benign Het
Pdzd7 T C 19: 45,039,285 N250S possibly damaging Het
Phkb A G 8: 85,922,182 D209G probably damaging Het
Pigs T G 11: 78,329,075 I92S possibly damaging Het
Pigz G T 16: 31,944,621 G166C probably damaging Het
Pkd1l2 C A 8: 117,030,649 R1550L probably damaging Het
Pkd2l1 A G 19: 44,192,156 V40A probably benign Het
Plxna1 A T 6: 89,324,634 M1470K probably damaging Het
Polq T A 16: 37,013,290 probably benign Het
Prune2 A G 19: 17,120,947 T1272A possibly damaging Het
Rfwd3 A T 8: 111,273,832 D720E probably damaging Het
Rgs12 C G 5: 34,966,111 Q413E probably benign Het
Rhobtb1 T A 10: 69,270,733 V376D possibly damaging Het
Rrp8 C T 7: 105,734,129 S310N probably damaging Het
S100a3 C T 3: 90,602,284 L79F probably damaging Het
Setbp1 C A 18: 78,858,063 M796I probably damaging Het
Slc4a7 C G 14: 14,782,138 H964Q probably damaging Het
Strc G T 2: 121,364,819 P1661Q probably benign Het
Taf5l A T 8: 124,009,820 V4E possibly damaging Het
Tbc1d15 T C 10: 115,233,218 E82G probably damaging Het
Thada A G 17: 84,432,254 S858P probably benign Het
Ticrr T C 7: 79,660,809 V157A probably damaging Het
Trim21 T C 7: 102,559,256 T419A probably benign Het
Vmn2r60 G T 7: 42,135,730 W122L probably damaging Het
Vwa3b C A 1: 37,100,706 Y369* probably null Het
Ythdf3 T C 3: 16,183,500 S2P possibly damaging Het
Other mutations in Sipa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Sipa1 APN 19 5660978 start codon destroyed probably null 0.79
IGL01837:Sipa1 APN 19 5652071 missense probably damaging 0.98
IGL02858:Sipa1 APN 19 5655708 missense probably damaging 0.99
IGL03024:Sipa1 APN 19 5656161 missense probably damaging 1.00
R0277:Sipa1 UTSW 19 5654065 missense probably benign
R0831:Sipa1 UTSW 19 5660354 missense probably damaging 1.00
R0841:Sipa1 UTSW 19 5654807 missense probably benign 0.06
R1102:Sipa1 UTSW 19 5652754 missense probably benign
R1459:Sipa1 UTSW 19 5651664 missense probably damaging 1.00
R1460:Sipa1 UTSW 19 5651447 missense probably benign
R2422:Sipa1 UTSW 19 5652112 missense possibly damaging 0.47
R3741:Sipa1 UTSW 19 5654857 missense probably damaging 1.00
R3924:Sipa1 UTSW 19 5660379 missense probably benign 0.05
R4231:Sipa1 UTSW 19 5654089 missense probably damaging 1.00
R4525:Sipa1 UTSW 19 5651957 missense probably benign 0.12
R4721:Sipa1 UTSW 19 5660385 missense probably damaging 0.99
R5176:Sipa1 UTSW 19 5659378 missense probably damaging 1.00
R5267:Sipa1 UTSW 19 5655758 missense probably benign 0.10
R5375:Sipa1 UTSW 19 5659612 missense probably damaging 0.99
R5582:Sipa1 UTSW 19 5654701 missense probably benign 0.00
R6005:Sipa1 UTSW 19 5656201 missense probably damaging 1.00
R6329:Sipa1 UTSW 19 5651489 missense probably damaging 1.00
R6712:Sipa1 UTSW 19 5660819 missense possibly damaging 0.69
R7209:Sipa1 UTSW 19 5654975 missense probably damaging 1.00
R7213:Sipa1 UTSW 19 5660523 missense probably damaging 1.00
R7665:Sipa1 UTSW 19 5651671 missense probably benign 0.00
X0057:Sipa1 UTSW 19 5654920 nonsense probably null
X0064:Sipa1 UTSW 19 5652736 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAGCTTCCTCGGAGATAGGC -3'
(R):5'- GAATACCTAGGGTGGTACTTCTGTG -3'

Sequencing Primer
(F):5'- TTCCTCGGAGATAGGCCCCTC -3'
(R):5'- TGTGGTGGGCGTAGTCAAGAAG -3'
Posted On2016-10-06