Incidental Mutation 'R5481:Barhl1'
ID434298
Institutional Source Beutler Lab
Gene Symbol Barhl1
Ensembl Gene ENSMUSG00000026805
Gene NameBarH like homeobox 1
SynonymsDres115, MBH2
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R5481 (G1)
Quality Score187
Status Not validated
Chromosome2
Chromosomal Location28907679-28916668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28915340 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 114 (Y114H)
Ref Sequence ENSEMBL: ENSMUSP00000109480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050776] [ENSMUST00000113847] [ENSMUST00000113849]
Predicted Effect probably damaging
Transcript: ENSMUST00000050776
AA Change: Y114H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053147
Gene: ENSMUSG00000026805
AA Change: Y114H

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113847
AA Change: Y114H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109478
Gene: ENSMUSG00000026805
AA Change: Y114H

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113849
AA Change: Y114H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109480
Gene: ENSMUSG00000026805
AA Change: Y114H

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124059
SMART Domains Protein: ENSMUSP00000134363
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 76 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174027
SMART Domains Protein: ENSMUSP00000134118
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
HOX 1 32 2.5e-3 SMART
low complexity region 101 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive hearing loss starting at 2 weeks of age. Animals are completely deaf by 10 months of age and show degeneration of the inner and outer cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Barhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Barhl1 APN 2 28915546 missense probably benign 0.03
IGL02337:Barhl1 APN 2 28911419 missense probably damaging 1.00
IGL03113:Barhl1 APN 2 28915456 missense probably benign 0.03
R0449:Barhl1 UTSW 2 28915292 missense probably benign 0.06
R1675:Barhl1 UTSW 2 28915411 missense possibly damaging 0.86
R1829:Barhl1 UTSW 2 28909845 missense probably damaging 1.00
R3615:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R3616:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R4937:Barhl1 UTSW 2 28909773 missense probably damaging 1.00
R6075:Barhl1 UTSW 2 28915219 missense probably damaging 0.99
R6727:Barhl1 UTSW 2 28915483 missense probably benign 0.01
R6728:Barhl1 UTSW 2 28915483 missense probably benign 0.01
R7096:Barhl1 UTSW 2 28909714 missense probably benign
R7123:Barhl1 UTSW 2 28909931 splice site probably null
R7336:Barhl1 UTSW 2 28909843 missense probably benign 0.40
R7339:Barhl1 UTSW 2 28909887 missense probably damaging 1.00
R7584:Barhl1 UTSW 2 28909791 missense probably damaging 0.99
X0065:Barhl1 UTSW 2 28915339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCAAGTGTGTGCTCTCAAG -3'
(R):5'- ATGGCTTTGGGATTGACTCC -3'

Sequencing Primer
(F):5'- CAAGTGTGTGCTCTCAAGTTTTAC -3'
(R):5'- TGAGTCCACGCTCAGAGAG -3'
Posted On2016-10-06