Incidental Mutation 'R5481:Chrna1'
ID434301
Institutional Source Beutler Lab
Gene Symbol Chrna1
Ensembl Gene ENSMUSG00000027107
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)
SynonymsAcra, Achr-1
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location73563215-73580338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73566926 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 340 (I340F)
Ref Sequence ENSEMBL: ENSMUSP00000028515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028515]
PDB Structure
Crystal structure of the extracellular domain of the nicotinic acetylcholine receptor 1 subunit bound to alpha-bungarotoxin at 1.9 A resolution [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028515
AA Change: I340F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028515
Gene: ENSMUSG00000027107
AA Change: I340F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 231 1.5e-72 PFAM
Pfam:Neur_chan_memb 238 446 1.1e-67 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an alpha subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The alpha subunit plays a role in substrate binding and channel gating. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, kyphosis, carpotosis, absent miniature and nerve-evoked endplant potential, increased motor neuron number, and abnormal neuromuscular synapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Chrna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Chrna1 APN 2 73570642 missense probably benign
IGL02043:Chrna1 APN 2 73568106 missense probably benign 0.00
IGL02553:Chrna1 APN 2 73566862 missense possibly damaging 0.79
IGL02663:Chrna1 APN 2 73574316 splice site probably benign
IGL02799:Chrna1 APN 2 73574641 splice site probably benign
IGL03369:Chrna1 APN 2 73570445 missense probably benign 0.02
R0113:Chrna1 UTSW 2 73566836 missense possibly damaging 0.88
R0513:Chrna1 UTSW 2 73568082 splice site probably benign
R0540:Chrna1 UTSW 2 73571471 missense probably damaging 1.00
R0561:Chrna1 UTSW 2 73566252 missense possibly damaging 0.84
R1922:Chrna1 UTSW 2 73568232 missense probably damaging 1.00
R5303:Chrna1 UTSW 2 73566274 missense probably benign
R5598:Chrna1 UTSW 2 73566731 missense probably benign 0.01
R5931:Chrna1 UTSW 2 73568100 missense probably benign 0.39
R6153:Chrna1 UTSW 2 73573309 missense probably benign 0.02
R6194:Chrna1 UTSW 2 73570472 missense probably benign 0.17
R6301:Chrna1 UTSW 2 73570484 missense possibly damaging 0.92
R6455:Chrna1 UTSW 2 73566836 missense possibly damaging 0.88
X0026:Chrna1 UTSW 2 73570611 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ATGGCGCTTTTCACCTCAG -3'
(R):5'- ATAATGCAGCGTTGGCGAC -3'

Sequencing Primer
(F):5'- ACCTCAGGGTGCTTGATCAG -3'
(R):5'- AATGCAGCCTGGAGCCTTTG -3'
Posted On2016-10-06