Incidental Mutation 'R5481:Sema4a'
ID434306
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
SynonymsSemB, Semab, SemB
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.900) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88435959-88461182 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88453040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 77 (Y77*)
Ref Sequence ENSEMBL: ENSMUSP00000139159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000123753] [ENSMUST00000125526] [ENSMUST00000127436] [ENSMUST00000141471] [ENSMUST00000147200] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222] [ENSMUST00000184487] [ENSMUST00000184876] [ENSMUST00000185137]
Predicted Effect probably null
Transcript: ENSMUST00000029700
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107531
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123753
Predicted Effect probably null
Transcript: ENSMUST00000125526
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000119028
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 113 8.2e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127436
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000118706
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 234 5.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135732
Predicted Effect probably benign
Transcript: ENSMUST00000141471
SMART Domains Protein: ENSMUSP00000114330
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146921
Predicted Effect probably null
Transcript: ENSMUST00000147200
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000123061
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 203 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect probably null
Transcript: ENSMUST00000165898
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166237
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169222
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184487
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000139126
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 168 1.5e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184876
AA Change: Y77*
SMART Domains Protein: ENSMUSP00000139159
Gene: ENSMUSG00000028064
AA Change: Y77*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 179 7.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184972
Predicted Effect probably benign
Transcript: ENSMUST00000185137
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88449810 missense probably damaging 1.00
IGL01722:Sema4a APN 3 88438184 missense probably benign 0.14
IGL01769:Sema4a APN 3 88449756 missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88450522 missense probably damaging 0.99
IGL02202:Sema4a APN 3 88449743 missense probably damaging 1.00
R0145:Sema4a UTSW 3 88451422 missense probably damaging 1.00
R0386:Sema4a UTSW 3 88436800 missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88453098 missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88448149 unclassified probably benign
R1567:Sema4a UTSW 3 88452046 missense probably damaging 1.00
R1675:Sema4a UTSW 3 88454766 missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88436838 missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88436749 missense probably benign 0.04
R1961:Sema4a UTSW 3 88438176 splice site probably benign
R2029:Sema4a UTSW 3 88451361 missense probably damaging 1.00
R4934:Sema4a UTSW 3 88438261 missense probably damaging 1.00
R5006:Sema4a UTSW 3 88436784 missense probably benign
R5309:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5312:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5338:Sema4a UTSW 3 88451497 missense probably benign 0.01
R5510:Sema4a UTSW 3 88449986 critical splice donor site probably null
R6046:Sema4a UTSW 3 88440701 missense probably damaging 1.00
R7242:Sema4a UTSW 3 88450109 missense probably damaging 1.00
R8403:Sema4a UTSW 3 88452034 missense probably damaging 0.98
R8798:Sema4a UTSW 3 88436697 missense possibly damaging 0.76
Z1176:Sema4a UTSW 3 88437193 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCACTGCTGACTCAGAGTG -3'
(R):5'- CCCTGCTGTTGAAGGATGAAGG -3'

Sequencing Primer
(F):5'- CTGACTCAGAGTGGCAGGTG -3'
(R):5'- CCTGCTGTTGAAGGATGAAGGAAATG -3'
Posted On2016-10-06