Incidental Mutation 'R5481:Nos1'
ID434317
Institutional Source Beutler Lab
Gene Symbol Nos1
Ensembl Gene ENSMUSG00000029361
Gene Namenitric oxide synthase 1, neuronal
SynonymsbNOS, nNOS, 2310005C01Rik, Nos-1, NO
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location117781032-117958840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117867754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 180 (I180F)
Ref Sequence ENSEMBL: ENSMUSP00000099617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086451] [ENSMUST00000102557] [ENSMUST00000138579] [ENSMUST00000142742] [ENSMUST00000171055]
Predicted Effect probably benign
Transcript: ENSMUST00000086451
AA Change: I180F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138506
Gene: ENSMUSG00000029361
AA Change: I180F

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 1e-226 PFAM
Pfam:Flavodoxin_1 757 930 3.5e-56 PFAM
Pfam:FAD_binding_1 985 1214 1.1e-84 PFAM
Pfam:NAD_binding_1 1246 1360 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102557
AA Change: I180F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099617
Gene: ENSMUSG00000029361
AA Change: I180F

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 350 712 2e-196 PFAM
Pfam:Flavodoxin_1 757 964 2.3e-55 PFAM
Pfam:FAD_binding_1 1019 1248 2.9e-88 PFAM
Pfam:NAD_binding_1 1280 1394 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124194
Predicted Effect probably benign
Transcript: ENSMUST00000138579
SMART Domains Protein: ENSMUSP00000138176
Gene: ENSMUSG00000029361

DomainStartEndE-ValueType
PDZ 26 80 1.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142742
AA Change: I180F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120421
Gene: ENSMUSG00000029361
AA Change: I180F

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171055
AA Change: I180F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127432
Gene: ENSMUSG00000029361
AA Change: I180F

DomainStartEndE-ValueType
PDZ 26 100 2.73e-16 SMART
Pfam:NO_synthase 346 717 4e-226 PFAM
Pfam:Flavodoxin_1 757 930 1.5e-55 PFAM
Pfam:FAD_binding_1 985 1214 3.2e-84 PFAM
Pfam:NAD_binding_1 1246 1360 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of nitric oxide synthases, which synthesize nitric oxide from L-arginine. Nitric oxide is a reactive free radical, which acts as a biologic mediator in several processes, including neurotransmission, and antimicrobial and antitumoral activities. In the brain and peripheral nervous system, nitric oxide displays many properties of a neurotransmitter, and has been implicated in neurotoxicity associated with stroke and neurodegenerative diseases, neural regulation of smooth muscle, including peristalsis, and penile erection. This protein is ubiquitously expressed, with high level of expression in skeletal muscle. Multiple transcript variants that differ in the 5' UTR have been described for this gene but the full-length nature of these transcripts is not known. Additionally, alternatively spliced transcript variants encoding different isoforms (some testis-specific) have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice exhibit enlarged stomachs, abnormal pyloric and lower esophageal sphincters, age-related cardiac hypertrophy, altered alcohol consumption and responses, decreased ovulation and reduced REM sleep. Homozygous null mice display increased neurogenesis in the adult brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Nos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nos1 APN 5 117910100 missense probably damaging 0.99
IGL01155:Nos1 APN 5 117945926 missense probably damaging 0.99
IGL01462:Nos1 APN 5 117867709 missense probably benign 0.10
IGL01464:Nos1 APN 5 117943192 missense probably damaging 1.00
IGL01620:Nos1 APN 5 117905309 critical splice acceptor site probably null
IGL01621:Nos1 APN 5 117945884 missense probably damaging 1.00
IGL01796:Nos1 APN 5 117938274 nonsense probably null
IGL02003:Nos1 APN 5 117905465 missense probably damaging 1.00
IGL02274:Nos1 APN 5 117897780 missense probably damaging 1.00
IGL02885:Nos1 APN 5 117895790 missense probably damaging 1.00
IGL02947:Nos1 APN 5 117943317 missense probably damaging 0.99
IGL03088:Nos1 APN 5 117867258 missense probably damaging 1.00
IGL03166:Nos1 APN 5 117914452 splice site probably benign
squanderer UTSW 5 117910238 missense probably damaging 0.97
R0007:Nos1 UTSW 5 117910088 missense probably damaging 1.00
R0012:Nos1 UTSW 5 117893902 missense probably damaging 1.00
R0080:Nos1 UTSW 5 117893878 missense probably damaging 1.00
R0212:Nos1 UTSW 5 117910212 missense possibly damaging 0.57
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0240:Nos1 UTSW 5 117867883 missense probably benign
R0454:Nos1 UTSW 5 117943320 missense probably benign 0.00
R0494:Nos1 UTSW 5 117905474 missense probably damaging 1.00
R0882:Nos1 UTSW 5 117947447 missense probably damaging 1.00
R1099:Nos1 UTSW 5 117923395 missense probably damaging 0.96
R1243:Nos1 UTSW 5 117905472 missense probably damaging 1.00
R1387:Nos1 UTSW 5 117953783 splice site probably benign
R1432:Nos1 UTSW 5 117949619 splice site probably benign
R1698:Nos1 UTSW 5 117867232 missense probably benign 0.01
R1710:Nos1 UTSW 5 117895919 missense probably damaging 1.00
R1859:Nos1 UTSW 5 117905462 missense possibly damaging 0.83
R1973:Nos1 UTSW 5 117936426 missense possibly damaging 0.52
R2084:Nos1 UTSW 5 117943245 missense probably damaging 1.00
R2112:Nos1 UTSW 5 117936571 missense probably benign 0.00
R4689:Nos1 UTSW 5 117879385 missense probably benign 0.04
R4769:Nos1 UTSW 5 117943245 nonsense probably null
R4893:Nos1 UTSW 5 117952877 missense possibly damaging 0.50
R4916:Nos1 UTSW 5 117947570 critical splice donor site probably null
R4956:Nos1 UTSW 5 117947510 missense probably benign
R4971:Nos1 UTSW 5 117943834 missense probably benign 0.05
R4987:Nos1 UTSW 5 117926533 critical splice donor site probably null
R5015:Nos1 UTSW 5 117867269 missense probably damaging 1.00
R5031:Nos1 UTSW 5 117879313 missense probably benign
R5137:Nos1 UTSW 5 117905313 missense probably benign 0.29
R5541:Nos1 UTSW 5 117905394 missense probably damaging 1.00
R5655:Nos1 UTSW 5 117923257 missense probably damaging 1.00
R5866:Nos1 UTSW 5 117895902 missense probably damaging 0.97
R5934:Nos1 UTSW 5 117936445 missense probably damaging 0.99
R6158:Nos1 UTSW 5 117867574 missense probably benign 0.05
R6225:Nos1 UTSW 5 117912852 missense probably damaging 1.00
R6261:Nos1 UTSW 5 117936570 missense probably benign
R6388:Nos1 UTSW 5 117914436 missense possibly damaging 0.91
R6987:Nos1 UTSW 5 117895785 missense probably benign 0.05
R7104:Nos1 UTSW 5 117947431 missense probably damaging 1.00
R7136:Nos1 UTSW 5 117895860 missense possibly damaging 0.95
R7276:Nos1 UTSW 5 117910238 missense probably damaging 0.97
R7299:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7301:Nos1 UTSW 5 117867905 missense possibly damaging 0.89
R7402:Nos1 UTSW 5 117949815 missense probably benign 0.34
R7408:Nos1 UTSW 5 117867518 missense probably damaging 1.00
R7618:Nos1 UTSW 5 117903944 missense probably benign 0.01
R7689:Nos1 UTSW 5 117897727 missense probably damaging 0.98
X0025:Nos1 UTSW 5 117943825 missense probably benign 0.00
X0026:Nos1 UTSW 5 117943152 missense probably damaging 1.00
Z1177:Nos1 UTSW 5 117923278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTTACTACACACCTGGAGACC -3'
(R):5'- TAGCTTACCTGTCCACCTGG -3'

Sequencing Primer
(F):5'- ACCTTCACAGGGGATGGAACC -3'
(R):5'- CCACCTGGATTCCTGTGTC -3'
Posted On2016-10-06