Mutagenetix > Incidental Mutation

Incidental Mutation 'R5481:P2rx7'

434318

Institutional Source

Beutler Lab

Gene Symbol

P2rx7

Ensembl Gene

ENSMUSG00000029468

Gene Name

purinergic receptor P2X, ligand-gated ion channel, 7

Synonyms

P2X7R, P2X7 receptor, P2X(7)

MMRRC Submission

043042-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5481 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122643911-122691432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122680820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 435 (D435G)

Ref Sequence

ENSEMBL: ENSMUSP00000098303 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]

AlphaFold

Q9Z1M0

Predicted Effect

probably benign
Transcript: ENSMUST00000031425

SMART Domains

Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	1e-149	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100737
AA Change: D435G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: D435G

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	397	3.6e-158	PFAM
low complexity region	435	451	N/A	INTRINSIC
low complexity region	516	536	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121489

SMART Domains

Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	3.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197102

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199371

Coding Region Coverage

1x: 99.1%
3x: 97.6%
10x: 95.1%
20x: 90.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,562	S187P	probably damaging	Het
Aass	C	A	6: 23,113,476	V282L	probably benign	Het
Adh6a	G	T	3: 138,325,958	V204F	probably damaging	Het
Aspm	A	G	1: 139,457,061	K148E	possibly damaging	Het
Atp12a	A	T	14: 56,373,389	D330V	possibly damaging	Het
Barhl1	A	G	2: 28,915,340	Y114H	probably damaging	Het
BC106179	T	A	16: 23,224,168		probably benign	Het
Cabin1	A	G	10: 75,735,066	L792P	probably benign	Het
Calcoco2	A	G	11: 96,107,543	V18A	probably damaging	Het
Chpf2	A	T	5: 24,589,342	H170L	probably damaging	Het
Chrna1	T	A	2: 73,566,926	I340F	possibly damaging	Het
Ckap5	A	T	2: 91,572,447	I690F	possibly damaging	Het
Col10a1	A	G	10: 34,395,664	H544R	probably benign	Het
Cyp2b19	A	C	7: 26,766,821	T350P	probably damaging	Het
Dgkq	A	G	5: 108,648,810		probably null	Het
Dnah1	A	G	14: 31,308,871	V443A	possibly damaging	Het
Erbb3	T	C	10: 128,572,480	D855G	probably damaging	Het
Fam3c	T	C	6: 22,321,358	D138G	probably benign	Het
Fen1	A	G	19: 10,200,658	C141R	probably damaging	Het
Flnc	G	A	6: 29,441,217	G390D	probably damaging	Het
Fnip1	C	A	11: 54,502,644	D635E	probably benign	Het
Fry	A	T	5: 150,260,319	L17F	probably benign	Het
Fsip2	T	C	2: 82,979,886	I2183T	probably benign	Het
Gfpt1	T	A	6: 87,050,969	I19N	probably damaging	Het
Gm9774	A	G	3: 92,429,351	S15P	possibly damaging	Het
Hus1b	T	C	13: 30,946,959	D239G	probably benign	Het
Kif1a	T	C	1: 93,060,244	K546R	probably benign	Het
Kmt2d	A	G	15: 98,862,005	V1124A	unknown	Het
Krtap16-1	A	G	11: 99,985,327	I417T	probably damaging	Het
Manba	A	T	3: 135,524,556	N297Y	possibly damaging	Het
Mblac1	A	G	5: 138,194,816	D140G	probably damaging	Het
Mlh1	T	C	9: 111,229,837		probably null	Het
Morc1	T	A	16: 48,561,485		probably null	Het
Morc3	C	A	16: 93,862,655	P449Q	probably damaging	Het
Mtr	T	C	13: 12,188,155		probably null	Het
Mylk	T	A	16: 34,921,604	C829S	probably benign	Het
Myo1d	A	G	11: 80,663,095	I520T	possibly damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nos1	A	T	5: 117,867,754	I180F	probably benign	Het
Ntsr1	C	T	2: 180,541,520	T341M	possibly damaging	Het
Olfr916	A	T	9: 38,657,620	F257L	probably benign	Het
Peli2	C	A	14: 48,252,633	N136K	probably damaging	Het
Pigt	C	A	2: 164,506,422	P429H	probably damaging	Het
Pik3r2	T	C	8: 70,769,764	I515V	probably benign	Het
Pkhd1l1	A	G	15: 44,558,646	Y3104C	probably damaging	Het
Ppp1r16a	A	C	15: 76,691,021	E43A	probably damaging	Het
Ptpn18	T	C	1: 34,471,663	L260P	possibly damaging	Het
Scaf11	A	T	15: 96,420,617	S355R	probably damaging	Het
Sema4a	A	T	3: 88,453,040	Y77*	probably null	Het
Serpinb9b	T	C	13: 33,038,093	V230A	possibly damaging	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc22a30	T	C	19: 8,336,837	N495S	probably benign	Het
Srcap	G	A	7: 127,532,197	G836D	probably damaging	Het
Stard4	A	C	18: 33,205,245	C137W	probably benign	Het
Stat6	A	G	10: 127,647,826		probably null	Het
Steap3	T	C	1: 120,241,724	D243G	probably benign	Het
Taf1c	A	G	8: 119,599,240	S628P	probably damaging	Het
Unkl	C	T	17: 25,201,172	Q13*	probably null	Het
Usp38	A	G	8: 80,993,323	S426P	possibly damaging	Het
Vmn2r8	T	C	5: 108,801,770	T404A	probably benign	Het
Washc1	T	C	17: 66,118,865	V425A	probably benign	Het
Zfyve9	A	G	4: 108,644,349	I590T	probably damaging	Het

Other mutations in P2rx7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:P2rx7	APN	5	122676698	missense	probably damaging	1.00
IGL01911:P2rx7	APN	5	122658768	missense	probably damaging	0.99
IGL02375:P2rx7	APN	5	122673656	splice site	probably benign
IGL02502:P2rx7	APN	5	122680987	missense	possibly damaging	0.92
IGL03102:P2rx7	APN	5	122663605	missense	possibly damaging	0.88
IGL03179:P2rx7	APN	5	122673700	missense	possibly damaging	0.66
ailing	UTSW	5	122673736	missense	probably benign
Enfermo	UTSW	5	122652789	missense	probably damaging	0.98
Incapacitated	UTSW	5	122673793	missense	probably damaging	0.99
Sickpuppy	UTSW	5	122681003	missense	probably damaging	0.96
Stumped	UTSW	5	122652726	critical splice acceptor site	probably null
BB009:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
BB019:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
PIT1430001:P2rx7	UTSW	5	122681216	missense	probably damaging	0.99
R0363:P2rx7	UTSW	5	122657030	nonsense	probably null
R0558:P2rx7	UTSW	5	122673798	missense	possibly damaging	0.83
R1186:P2rx7	UTSW	5	122670451	missense	probably damaging	1.00
R1709:P2rx7	UTSW	5	122670465	missense	possibly damaging	0.95
R1856:P2rx7	UTSW	5	122681032	missense	probably damaging	1.00
R1899:P2rx7	UTSW	5	122673736	missense	probably benign
R1905:P2rx7	UTSW	5	122680952	missense	probably damaging	1.00
R2082:P2rx7	UTSW	5	122644095	missense	possibly damaging	0.92
R2117:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R2205:P2rx7	UTSW	5	122681101	missense	probably damaging	1.00
R2446:P2rx7	UTSW	5	122680816	missense	probably benign
R3151:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R4052:P2rx7	UTSW	5	122666277	missense	probably damaging	1.00
R4883:P2rx7	UTSW	5	122681066	missense	probably damaging	1.00
R4930:P2rx7	UTSW	5	122670479	missense	probably damaging	1.00
R5194:P2rx7	UTSW	5	122673795	missense	probably benign	0.00
R5257:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5258:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5656:P2rx7	UTSW	5	122673717	missense	probably damaging	0.99
R5738:P2rx7	UTSW	5	122652789	missense	probably damaging	0.98
R6587:P2rx7	UTSW	5	122664550	missense	probably damaging	1.00
R7098:P2rx7	UTSW	5	122673793	missense	probably damaging	0.99
R7120:P2rx7	UTSW	5	122681294	missense	probably benign
R7180:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R7358:P2rx7	UTSW	5	122666142	critical splice acceptor site	probably null
R7724:P2rx7	UTSW	5	122673373	missense	probably benign	0.07
R7932:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
R8240:P2rx7	UTSW	5	122655033	missense	probably damaging	1.00
R8425:P2rx7	UTSW	5	122670458	missense	probably damaging	0.96
R9140:P2rx7	UTSW	5	122652726	critical splice acceptor site	probably null
R9331:P2rx7	UTSW	5	122680898	missense	probably benign	0.01
R9623:P2rx7	UTSW	5	122652797	missense	probably damaging	1.00
Z1177:P2rx7	UTSW	5	122663641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCTTAGCAGGCTTAACAGC -3'
(R):5'- GCACGAGCTTATGGAAGAGC -3'

Sequencing Primer
(F):5'- TTAACAGCAGCCCAGCCCTG -3'
(R):5'- TTCCTCCGGCAGCACAG -3'

Posted On

2016-10-06