Incidental Mutation 'R5481:Col10a1'
ID434335
Institutional Source Beutler Lab
Gene Symbol Col10a1
Ensembl Gene ENSMUSG00000039462
Gene Namecollagen, type X, alpha 1
SynonymsCol10a-1, Col10
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location34389981-34397085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34395664 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 544 (H544R)
Ref Sequence ENSEMBL: ENSMUSP00000101150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047885] [ENSMUST00000099973] [ENSMUST00000105511] [ENSMUST00000105512] [ENSMUST00000213269]
Predicted Effect probably benign
Transcript: ENSMUST00000047885
SMART Domains Protein: ENSMUSP00000047126
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 382 2.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099973
SMART Domains Protein: ENSMUSP00000097553
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 189 8.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105511
AA Change: H544R

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101150
Gene: ENSMUSG00000039462
AA Change: H544R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 60 101 N/A INTRINSIC
Pfam:Collagen 103 155 1.4e-9 PFAM
Pfam:Collagen 153 218 1.4e-8 PFAM
Pfam:Collagen 193 250 2.6e-9 PFAM
Pfam:Collagen 206 264 3.8e-8 PFAM
low complexity region 282 323 N/A INTRINSIC
internal_repeat_2 329 361 2.25e-6 PROSPERO
internal_repeat_1 331 365 5.9e-14 PROSPERO
low complexity region 368 383 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
Pfam:Collagen 413 483 9.3e-10 PFAM
low complexity region 487 517 N/A INTRINSIC
C1Q 545 680 2.85e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105512
SMART Domains Protein: ENSMUSP00000101151
Gene: ENSMUSG00000039480

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 372 8.7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130290
Predicted Effect probably benign
Transcript: ENSMUST00000213269
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type X collagen, a short chain collagen expressed by hypertrophic chondrocytes during endochondral ossification. Unlike type VIII collagen, the other short chain collagen, type X collagen is a homotrimer. Mutations in this gene are associated with Schmid type metaphyseal chondrodysplasia (SMCD) and Japanese type spondylometaphyseal dysplasia (SMD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations may exhibit abnormal trabecular bone, thinner growth plate resting zone and articular cartilage, and altered bone content. Mice homozygous for another knock-out allele exhibit altered B and T cell populations and TH1/TH2responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Col10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03005:Col10a1 APN 10 34395738 missense probably damaging 1.00
IGL03028:Col10a1 APN 10 34395016 missense probably benign 0.19
R0580:Col10a1 UTSW 10 34394952 missense probably benign 0.31
R0691:Col10a1 UTSW 10 34395696 missense possibly damaging 0.94
R1187:Col10a1 UTSW 10 34394838 missense probably benign 0.13
R1597:Col10a1 UTSW 10 34395078 missense probably damaging 0.99
R1724:Col10a1 UTSW 10 34395718 missense probably damaging 1.00
R1826:Col10a1 UTSW 10 34394649 missense probably damaging 1.00
R1834:Col10a1 UTSW 10 34395015 missense probably damaging 1.00
R2156:Col10a1 UTSW 10 34395700 missense probably benign 0.30
R3687:Col10a1 UTSW 10 34395498 missense probably benign 0.12
R4208:Col10a1 UTSW 10 34395543 missense probably damaging 0.99
R4929:Col10a1 UTSW 10 34395124 missense probably benign 0.00
R5411:Col10a1 UTSW 10 34394557 missense probably damaging 1.00
R5433:Col10a1 UTSW 10 34390739 intron probably benign
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6036:Col10a1 UTSW 10 34395282 missense probably benign
R6208:Col10a1 UTSW 10 34394586 missense possibly damaging 0.69
R6223:Col10a1 UTSW 10 34395187 missense probably damaging 1.00
R7019:Col10a1 UTSW 10 34394951 missense probably damaging 0.96
R7642:Col10a1 UTSW 10 34395642 missense probably benign 0.00
R7784:Col10a1 UTSW 10 34394218 missense unknown
R8072:Col10a1 UTSW 10 34390667 missense unknown
R8711:Col10a1 UTSW 10 34394828 missense probably damaging 1.00
Z1176:Col10a1 UTSW 10 34395178 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAACTAAGGGCCTCAATGG -3'
(R):5'- TACAGGCCTACCCAAACGTGAG -3'

Sequencing Primer
(F):5'- TCAATGGGCCCACTGGTC -3'
(R):5'- CCTTTCACATGCACGTGGTAGG -3'
Posted On2016-10-06