Incidental Mutation 'R5481:Erbb3'
ID434338
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
MMRRC Submission 043042-MU
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128572480 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 855 (D855G)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
Predicted Effect probably damaging
Transcript: ENSMUST00000082059
AA Change: D855G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: D855G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Slc22a30 T C 19: 8,336,837 N495S probably benign Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128569847 missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128583200 missense probably damaging 0.99
R8843:Erbb3 UTSW 10 128578456 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGTGCTACCCATTAATTTTCACC -3'
(R):5'- CAGCTGCTATTGCTCAGTGG -3'

Sequencing Primer
(F):5'- GATCCCGCGAACTTAAATTTTCTG -3'
(R):5'- TATTGCTCAGTGGCCGAC -3'
Posted On2016-10-06