Mutagenetix > Incidental Mutation

Incidental Mutation 'R5481:Myo1d'

434342

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

043042-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5481 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80663095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 520 (I520T)

Ref Sequence

ENSEMBL: ENSMUSP00000066948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]

AlphaFold

Q5SYD0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041065
AA Change: I520T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: I520T

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070997
AA Change: I520T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: I520T

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	802	913	1.8e-26	PFAM

Coding Region Coverage

1x: 99.1%
3x: 97.6%
10x: 95.1%
20x: 90.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,562	S187P	probably damaging	Het
Aass	C	A	6: 23,113,476	V282L	probably benign	Het
Adh6a	G	T	3: 138,325,958	V204F	probably damaging	Het
Aspm	A	G	1: 139,457,061	K148E	possibly damaging	Het
Atp12a	A	T	14: 56,373,389	D330V	possibly damaging	Het
Barhl1	A	G	2: 28,915,340	Y114H	probably damaging	Het
BC106179	T	A	16: 23,224,168		probably benign	Het
Cabin1	A	G	10: 75,735,066	L792P	probably benign	Het
Calcoco2	A	G	11: 96,107,543	V18A	probably damaging	Het
Chpf2	A	T	5: 24,589,342	H170L	probably damaging	Het
Chrna1	T	A	2: 73,566,926	I340F	possibly damaging	Het
Ckap5	A	T	2: 91,572,447	I690F	possibly damaging	Het
Col10a1	A	G	10: 34,395,664	H544R	probably benign	Het
Cyp2b19	A	C	7: 26,766,821	T350P	probably damaging	Het
Dgkq	A	G	5: 108,648,810		probably null	Het
Dnah1	A	G	14: 31,308,871	V443A	possibly damaging	Het
Erbb3	T	C	10: 128,572,480	D855G	probably damaging	Het
Fam3c	T	C	6: 22,321,358	D138G	probably benign	Het
Fen1	A	G	19: 10,200,658	C141R	probably damaging	Het
Flnc	G	A	6: 29,441,217	G390D	probably damaging	Het
Fnip1	C	A	11: 54,502,644	D635E	probably benign	Het
Fry	A	T	5: 150,260,319	L17F	probably benign	Het
Fsip2	T	C	2: 82,979,886	I2183T	probably benign	Het
Gfpt1	T	A	6: 87,050,969	I19N	probably damaging	Het
Gm9774	A	G	3: 92,429,351	S15P	possibly damaging	Het
Hus1b	T	C	13: 30,946,959	D239G	probably benign	Het
Kif1a	T	C	1: 93,060,244	K546R	probably benign	Het
Kmt2d	A	G	15: 98,862,005	V1124A	unknown	Het
Krtap16-1	A	G	11: 99,985,327	I417T	probably damaging	Het
Manba	A	T	3: 135,524,556	N297Y	possibly damaging	Het
Mblac1	A	G	5: 138,194,816	D140G	probably damaging	Het
Mlh1	T	C	9: 111,229,837		probably null	Het
Morc1	T	A	16: 48,561,485		probably null	Het
Morc3	C	A	16: 93,862,655	P449Q	probably damaging	Het
Mtr	T	C	13: 12,188,155		probably null	Het
Mylk	T	A	16: 34,921,604	C829S	probably benign	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nos1	A	T	5: 117,867,754	I180F	probably benign	Het
Ntsr1	C	T	2: 180,541,520	T341M	possibly damaging	Het
Olfr916	A	T	9: 38,657,620	F257L	probably benign	Het
P2rx7	A	G	5: 122,680,820	D435G	possibly damaging	Het
Peli2	C	A	14: 48,252,633	N136K	probably damaging	Het
Pigt	C	A	2: 164,506,422	P429H	probably damaging	Het
Pik3r2	T	C	8: 70,769,764	I515V	probably benign	Het
Pkhd1l1	A	G	15: 44,558,646	Y3104C	probably damaging	Het
Ppp1r16a	A	C	15: 76,691,021	E43A	probably damaging	Het
Ptpn18	T	C	1: 34,471,663	L260P	possibly damaging	Het
Scaf11	A	T	15: 96,420,617	S355R	probably damaging	Het
Sema4a	A	T	3: 88,453,040	Y77*	probably null	Het
Serpinb9b	T	C	13: 33,038,093	V230A	possibly damaging	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc22a30	T	C	19: 8,336,837	N495S	probably benign	Het
Srcap	G	A	7: 127,532,197	G836D	probably damaging	Het
Stard4	A	C	18: 33,205,245	C137W	probably benign	Het
Stat6	A	G	10: 127,647,826		probably null	Het
Steap3	T	C	1: 120,241,724	D243G	probably benign	Het
Taf1c	A	G	8: 119,599,240	S628P	probably damaging	Het
Unkl	C	T	17: 25,201,172	Q13*	probably null	Het
Usp38	A	G	8: 80,993,323	S426P	possibly damaging	Het
Vmn2r8	T	C	5: 108,801,770	T404A	probably benign	Het
Washc1	T	C	17: 66,118,865	V425A	probably benign	Het
Zfyve9	A	G	4: 108,644,349	I590T	probably damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R3928:Myo1d	UTSW	11	80484261	missense	probably benign	0.09
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTAGTAGCTCCTGCCCCAAG -3'
(R):5'- GTGTGCAAGATCTAGCCTTTACCTC -3'

Sequencing Primer
(F):5'- GCCCCAAGTCTACAGATTTTATAATC -3'
(R):5'- AGCCTTTACCTCAGAGCTAAGTG -3'

Posted On

2016-10-06