Mutagenetix > Incidental Mutation

Incidental Mutation 'R5481:Mtr'

434345

Institutional Source

Beutler Lab

Gene Symbol

Mtr

Ensembl Gene

ENSMUSG00000021311

Gene Name

5-methyltetrahydrofolate-homocysteine methyltransferase

Synonyms

methionine synthase, D830038K18Rik, MS

MMRRC Submission

043042-MU

Accession Numbers

Genbank: NM_001081128

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5481 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12182712-12258113 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 12188155 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097442 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099856] [ENSMUST00000099856]

AlphaFold

A6H5Y3

Predicted Effect

probably null
Transcript: ENSMUST00000099856

SMART Domains

Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311

Domain	Start	End	E-Value	Type
Pfam:S-methyl_trans	18	326	1.5e-93	PFAM
Pfam:Pterin_bind	363	601	4.6e-63	PFAM
B12-binding_2	657	743	6.42e-41	SMART
Pfam:B12-binding	761	861	3.3e-20	PFAM
Pfam:Met_synt_B12	953	1234	2.5e-114	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000099856

SMART Domains

Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311

Domain	Start	End	E-Value	Type
Pfam:S-methyl_trans	18	326	1.5e-93	PFAM
Pfam:Pterin_bind	363	601	4.6e-63	PFAM
B12-binding_2	657	743	6.42e-41	SMART
Pfam:B12-binding	761	861	3.3e-20	PFAM
Pfam:Met_synt_B12	953	1234	2.5e-114	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220473

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221190

Coding Region Coverage

1x: 99.1%
3x: 97.6%
10x: 95.1%
20x: 90.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,562	S187P	probably damaging	Het
Aass	C	A	6: 23,113,476	V282L	probably benign	Het
Adh6a	G	T	3: 138,325,958	V204F	probably damaging	Het
Aspm	A	G	1: 139,457,061	K148E	possibly damaging	Het
Atp12a	A	T	14: 56,373,389	D330V	possibly damaging	Het
Barhl1	A	G	2: 28,915,340	Y114H	probably damaging	Het
BC106179	T	A	16: 23,224,168		probably benign	Het
Cabin1	A	G	10: 75,735,066	L792P	probably benign	Het
Calcoco2	A	G	11: 96,107,543	V18A	probably damaging	Het
Chpf2	A	T	5: 24,589,342	H170L	probably damaging	Het
Chrna1	T	A	2: 73,566,926	I340F	possibly damaging	Het
Ckap5	A	T	2: 91,572,447	I690F	possibly damaging	Het
Col10a1	A	G	10: 34,395,664	H544R	probably benign	Het
Cyp2b19	A	C	7: 26,766,821	T350P	probably damaging	Het
Dgkq	A	G	5: 108,648,810		probably null	Het
Dnah1	A	G	14: 31,308,871	V443A	possibly damaging	Het
Erbb3	T	C	10: 128,572,480	D855G	probably damaging	Het
Fam3c	T	C	6: 22,321,358	D138G	probably benign	Het
Fen1	A	G	19: 10,200,658	C141R	probably damaging	Het
Flnc	G	A	6: 29,441,217	G390D	probably damaging	Het
Fnip1	C	A	11: 54,502,644	D635E	probably benign	Het
Fry	A	T	5: 150,260,319	L17F	probably benign	Het
Fsip2	T	C	2: 82,979,886	I2183T	probably benign	Het
Gfpt1	T	A	6: 87,050,969	I19N	probably damaging	Het
Gm9774	A	G	3: 92,429,351	S15P	possibly damaging	Het
Hus1b	T	C	13: 30,946,959	D239G	probably benign	Het
Kif1a	T	C	1: 93,060,244	K546R	probably benign	Het
Kmt2d	A	G	15: 98,862,005	V1124A	unknown	Het
Krtap16-1	A	G	11: 99,985,327	I417T	probably damaging	Het
Manba	A	T	3: 135,524,556	N297Y	possibly damaging	Het
Mblac1	A	G	5: 138,194,816	D140G	probably damaging	Het
Mlh1	T	C	9: 111,229,837		probably null	Het
Morc1	T	A	16: 48,561,485		probably null	Het
Morc3	C	A	16: 93,862,655	P449Q	probably damaging	Het
Mylk	T	A	16: 34,921,604	C829S	probably benign	Het
Myo1d	A	G	11: 80,663,095	I520T	possibly damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nos1	A	T	5: 117,867,754	I180F	probably benign	Het
Ntsr1	C	T	2: 180,541,520	T341M	possibly damaging	Het
Olfr916	A	T	9: 38,657,620	F257L	probably benign	Het
P2rx7	A	G	5: 122,680,820	D435G	possibly damaging	Het
Peli2	C	A	14: 48,252,633	N136K	probably damaging	Het
Pigt	C	A	2: 164,506,422	P429H	probably damaging	Het
Pik3r2	T	C	8: 70,769,764	I515V	probably benign	Het
Pkhd1l1	A	G	15: 44,558,646	Y3104C	probably damaging	Het
Ppp1r16a	A	C	15: 76,691,021	E43A	probably damaging	Het
Ptpn18	T	C	1: 34,471,663	L260P	possibly damaging	Het
Scaf11	A	T	15: 96,420,617	S355R	probably damaging	Het
Sema4a	A	T	3: 88,453,040	Y77*	probably null	Het
Serpinb9b	T	C	13: 33,038,093	V230A	possibly damaging	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc22a30	T	C	19: 8,336,837	N495S	probably benign	Het
Srcap	G	A	7: 127,532,197	G836D	probably damaging	Het
Stard4	A	C	18: 33,205,245	C137W	probably benign	Het
Stat6	A	G	10: 127,647,826		probably null	Het
Steap3	T	C	1: 120,241,724	D243G	probably benign	Het
Taf1c	A	G	8: 119,599,240	S628P	probably damaging	Het
Unkl	C	T	17: 25,201,172	Q13*	probably null	Het
Usp38	A	G	8: 80,993,323	S426P	possibly damaging	Het
Vmn2r8	T	C	5: 108,801,770	T404A	probably benign	Het
Washc1	T	C	17: 66,118,865	V425A	probably benign	Het
Zfyve9	A	G	4: 108,644,349	I590T	probably damaging	Het

Other mutations in Mtr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01299:Mtr	APN	13	12225650	splice site	probably benign
IGL02456:Mtr	APN	13	12199094	missense	probably damaging	0.98
IGL02573:Mtr	APN	13	12199127	missense	possibly damaging	0.95
IGL02642:Mtr	APN	13	12195232	splice site	probably benign
IGL03005:Mtr	APN	13	12235449	splice site	probably benign
IGL03017:Mtr	APN	13	12247891	critical splice donor site	probably null
IGL03036:Mtr	APN	13	12247377	missense	probably damaging	1.00
H8930:Mtr	UTSW	13	12235460	missense	probably damaging	1.00
PIT4431001:Mtr	UTSW	13	12212443	missense	probably damaging	1.00
PIT4520001:Mtr	UTSW	13	12197985	nonsense	probably null
R0011:Mtr	UTSW	13	12238052	splice site	probably benign
R0047:Mtr	UTSW	13	12222226	missense	probably damaging	1.00
R0047:Mtr	UTSW	13	12222226	missense	probably damaging	1.00
R0304:Mtr	UTSW	13	12222154	critical splice donor site	probably null
R0617:Mtr	UTSW	13	12221432	missense	probably benign
R0842:Mtr	UTSW	13	12200247	missense	probably damaging	1.00
R1101:Mtr	UTSW	13	12189525	missense	possibly damaging	0.84
R1450:Mtr	UTSW	13	12193733	missense	probably damaging	0.99
R1534:Mtr	UTSW	13	12235544	splice site	probably benign
R1907:Mtr	UTSW	13	12225532	missense	probably damaging	1.00
R2111:Mtr	UTSW	13	12244601	missense	possibly damaging	0.86
R2354:Mtr	UTSW	13	12188157	splice site	probably benign
R3849:Mtr	UTSW	13	12247365	missense	probably benign	0.16
R3899:Mtr	UTSW	13	12216849	missense	probably benign	0.00
R4012:Mtr	UTSW	13	12189397	missense	probably damaging	1.00
R4012:Mtr	UTSW	13	12189398	missense	probably damaging	1.00
R4075:Mtr	UTSW	13	12215412	critical splice donor site	probably null
R4091:Mtr	UTSW	13	12231057	missense	probably damaging	1.00
R4655:Mtr	UTSW	13	12227793	missense	probably damaging	1.00
R4801:Mtr	UTSW	13	12195251	missense	probably benign	0.01
R4802:Mtr	UTSW	13	12195251	missense	probably benign	0.01
R4895:Mtr	UTSW	13	12216866	missense	probably benign	0.01
R5966:Mtr	UTSW	13	12215567	critical splice acceptor site	probably null
R6209:Mtr	UTSW	13	12190392	missense	probably benign	0.00
R6348:Mtr	UTSW	13	12247954	missense	possibly damaging	0.49
R6463:Mtr	UTSW	13	12216866	missense	probably benign	0.01
R6467:Mtr	UTSW	13	12188106	missense	probably damaging	1.00
R7046:Mtr	UTSW	13	12190209	missense	possibly damaging	0.58
R7505:Mtr	UTSW	13	12221476	missense	probably benign	0.02
R7575:Mtr	UTSW	13	12199077	missense	probably benign	0.01
R7705:Mtr	UTSW	13	12249896	missense	probably benign
R7748:Mtr	UTSW	13	12227839	missense	probably benign	0.00
R8161:Mtr	UTSW	13	12221486	missense	probably damaging	0.99
R8290:Mtr	UTSW	13	12190253	missense	probably damaging	1.00
R8988:Mtr	UTSW	13	12235479	missense	probably benign
R9050:Mtr	UTSW	13	12216862	missense	probably null	0.67
R9420:Mtr	UTSW	13	12253878	missense	probably benign	0.04
R9655:Mtr	UTSW	13	12188144	missense	probably damaging	1.00
X0064:Mtr	UTSW	13	12250657	missense	probably damaging	1.00
Z1177:Mtr	UTSW	13	12187049	missense	probably benign	0.32
Z1177:Mtr	UTSW	13	12249866	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAATAGATCCTACGGGTCCATC -3'
(R):5'- GAGCCTCTAACCCTGATCACAG -3'

Sequencing Primer
(F):5'- CGGGTCCATCTAAAGACAGTTATGC -3'
(R):5'- GGATGAAAGTCTTTCCCAGGC -3'

Posted On

2016-10-06