Mutagenetix > Incidental Mutation

Incidental Mutation 'R5481:Dnah1'

434348

Institutional Source

Beutler Lab

Gene Symbol

Dnah1

Ensembl Gene

ENSMUSG00000019027

Gene Name

dynein, axonemal, heavy chain 1

Synonyms

E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik

MMRRC Submission

043042-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5481 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31260375-31323896 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31308871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 443 (V443A)

Ref Sequence

ENSEMBL: ENSMUSP00000043281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048603]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048603
AA Change: V443A

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: V443A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DHC_N2	998	1404	6.3e-146	PFAM
AAA	1558	1697	6.02e-1	SMART
AAA	1839	2077	4.66e0	SMART
low complexity region	2149	2157	N/A	INTRINSIC
AAA	2204	2353	2.35e-1	SMART
Pfam:AAA_8	2533	2803	7.7e-84	PFAM
Pfam:MT	2815	3165	9.9e-57	PFAM
Pfam:AAA_9	3185	3410	1.1e-93	PFAM
Pfam:Dynein_heavy	3545	4246	2.7e-275	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228755

Coding Region Coverage

1x: 99.1%
3x: 97.6%
10x: 95.1%
20x: 90.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	A	G	4: 109,505,562	S187P	probably damaging	Het
Aass	C	A	6: 23,113,476	V282L	probably benign	Het
Adh6a	G	T	3: 138,325,958	V204F	probably damaging	Het
Aspm	A	G	1: 139,457,061	K148E	possibly damaging	Het
Atp12a	A	T	14: 56,373,389	D330V	possibly damaging	Het
Barhl1	A	G	2: 28,915,340	Y114H	probably damaging	Het
BC106179	T	A	16: 23,224,168		probably benign	Het
Cabin1	A	G	10: 75,735,066	L792P	probably benign	Het
Calcoco2	A	G	11: 96,107,543	V18A	probably damaging	Het
Chpf2	A	T	5: 24,589,342	H170L	probably damaging	Het
Chrna1	T	A	2: 73,566,926	I340F	possibly damaging	Het
Ckap5	A	T	2: 91,572,447	I690F	possibly damaging	Het
Col10a1	A	G	10: 34,395,664	H544R	probably benign	Het
Cyp2b19	A	C	7: 26,766,821	T350P	probably damaging	Het
Dgkq	A	G	5: 108,648,810		probably null	Het
Erbb3	T	C	10: 128,572,480	D855G	probably damaging	Het
Fam3c	T	C	6: 22,321,358	D138G	probably benign	Het
Fen1	A	G	19: 10,200,658	C141R	probably damaging	Het
Flnc	G	A	6: 29,441,217	G390D	probably damaging	Het
Fnip1	C	A	11: 54,502,644	D635E	probably benign	Het
Fry	A	T	5: 150,260,319	L17F	probably benign	Het
Fsip2	T	C	2: 82,979,886	I2183T	probably benign	Het
Gfpt1	T	A	6: 87,050,969	I19N	probably damaging	Het
Gm9774	A	G	3: 92,429,351	S15P	possibly damaging	Het
Hus1b	T	C	13: 30,946,959	D239G	probably benign	Het
Kif1a	T	C	1: 93,060,244	K546R	probably benign	Het
Kmt2d	A	G	15: 98,862,005	V1124A	unknown	Het
Krtap16-1	A	G	11: 99,985,327	I417T	probably damaging	Het
Manba	A	T	3: 135,524,556	N297Y	possibly damaging	Het
Mblac1	A	G	5: 138,194,816	D140G	probably damaging	Het
Mlh1	T	C	9: 111,229,837		probably null	Het
Morc1	T	A	16: 48,561,485		probably null	Het
Morc3	C	A	16: 93,862,655	P449Q	probably damaging	Het
Mtr	T	C	13: 12,188,155		probably null	Het
Mylk	T	A	16: 34,921,604	C829S	probably benign	Het
Myo1d	A	G	11: 80,663,095	I520T	possibly damaging	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nos1	A	T	5: 117,867,754	I180F	probably benign	Het
Ntsr1	C	T	2: 180,541,520	T341M	possibly damaging	Het
Olfr916	A	T	9: 38,657,620	F257L	probably benign	Het
P2rx7	A	G	5: 122,680,820	D435G	possibly damaging	Het
Peli2	C	A	14: 48,252,633	N136K	probably damaging	Het
Pigt	C	A	2: 164,506,422	P429H	probably damaging	Het
Pik3r2	T	C	8: 70,769,764	I515V	probably benign	Het
Pkhd1l1	A	G	15: 44,558,646	Y3104C	probably damaging	Het
Ppp1r16a	A	C	15: 76,691,021	E43A	probably damaging	Het
Ptpn18	T	C	1: 34,471,663	L260P	possibly damaging	Het
Scaf11	A	T	15: 96,420,617	S355R	probably damaging	Het
Sema4a	A	T	3: 88,453,040	Y77*	probably null	Het
Serpinb9b	T	C	13: 33,038,093	V230A	possibly damaging	Het
Sfswap	T	A	5: 129,514,818	S300T	probably damaging	Het
Slc22a30	T	C	19: 8,336,837	N495S	probably benign	Het
Srcap	G	A	7: 127,532,197	G836D	probably damaging	Het
Stard4	A	C	18: 33,205,245	C137W	probably benign	Het
Stat6	A	G	10: 127,647,826		probably null	Het
Steap3	T	C	1: 120,241,724	D243G	probably benign	Het
Taf1c	A	G	8: 119,599,240	S628P	probably damaging	Het
Unkl	C	T	17: 25,201,172	Q13*	probably null	Het
Usp38	A	G	8: 80,993,323	S426P	possibly damaging	Het
Vmn2r8	T	C	5: 108,801,770	T404A	probably benign	Het
Washc1	T	C	17: 66,118,865	V425A	probably benign	Het
Zfyve9	A	G	4: 108,644,349	I590T	probably damaging	Het

Other mutations in Dnah1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Dnah1	APN	14	31287873	missense	probably benign	0.01
IGL00227:Dnah1	APN	14	31286896	missense	probably damaging	1.00
IGL00491:Dnah1	APN	14	31261839	missense	probably damaging	1.00
IGL00787:Dnah1	APN	14	31300063	missense	possibly damaging	0.91
IGL00809:Dnah1	APN	14	31300809	nonsense	probably null
IGL00911:Dnah1	APN	14	31304434	splice site	probably null
IGL00949:Dnah1	APN	14	31307090	missense	probably benign	0.00
IGL00976:Dnah1	APN	14	31278138	missense	probably damaging	1.00
IGL01484:Dnah1	APN	14	31299940	missense	probably damaging	0.98
IGL01629:Dnah1	APN	14	31292320	missense	probably damaging	1.00
IGL01716:Dnah1	APN	14	31263378	missense	probably benign	0.34
IGL01893:Dnah1	APN	14	31266470	missense	probably damaging	1.00
IGL01933:Dnah1	APN	14	31310915	missense	probably benign	0.40
IGL01938:Dnah1	APN	14	31283887	missense	probably benign
IGL02032:Dnah1	APN	14	31274369	missense	probably benign
IGL02052:Dnah1	APN	14	31268786	missense	probably damaging	0.99
IGL02097:Dnah1	APN	14	31305001	missense	possibly damaging	0.92
IGL02127:Dnah1	APN	14	31304928	missense	probably benign	0.00
IGL02143:Dnah1	APN	14	31283289	missense	probably damaging	1.00
IGL02158:Dnah1	APN	14	31300967	missense	probably benign	0.00
IGL02442:Dnah1	APN	14	31287878	missense	probably damaging	1.00
IGL02525:Dnah1	APN	14	31305833	missense	probably benign	0.05
IGL02558:Dnah1	APN	14	31274379	missense	possibly damaging	0.96
IGL02633:Dnah1	APN	14	31284815	missense	probably benign	0.05
IGL02720:Dnah1	APN	14	31262220	missense	probably damaging	0.96
IGL02728:Dnah1	APN	14	31283998	missense	probably benign	0.44
IGL02738:Dnah1	APN	14	31292640	missense	probably benign	0.27
IGL02863:Dnah1	APN	14	31295293	missense	probably damaging	0.99
IGL02944:Dnah1	APN	14	31300871	missense	possibly damaging	0.88
IGL03110:Dnah1	APN	14	31266717	missense	probably benign	0.40
IGL03201:Dnah1	APN	14	31300949	missense	probably benign	0.13
IGL03215:Dnah1	APN	14	31274391	missense	probably damaging	1.00
IGL03230:Dnah1	APN	14	31270066	missense	probably damaging	1.00
IGL03248:Dnah1	APN	14	31269889	missense	probably damaging	1.00
IGL03267:Dnah1	APN	14	31286588	missense	probably benign	0.00
IGL03299:Dnah1	APN	14	31315122	nonsense	probably null
IGL03301:Dnah1	APN	14	31292692	missense	probably damaging	1.00
ergonomic	UTSW	14	31300748	missense	possibly damaging	0.91
Faraday	UTSW	14	31310882	missense	probably null	0.05
K3955:Dnah1	UTSW	14	31266459	missense	probably benign
PIT1430001:Dnah1	UTSW	14	31262580	missense	probably damaging	1.00
PIT4382001:Dnah1	UTSW	14	31284455	missense	probably damaging	1.00
R0043:Dnah1	UTSW	14	31274405	missense	probably damaging	0.97
R0092:Dnah1	UTSW	14	31271609	missense	probably benign	0.00
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0101:Dnah1	UTSW	14	31283899	missense	probably damaging	1.00
R0119:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0136:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0144:Dnah1	UTSW	14	31267874	splice site	probably benign
R0279:Dnah1	UTSW	14	31302375	missense	possibly damaging	0.94
R0299:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0316:Dnah1	UTSW	14	31278151	missense	probably benign	0.00
R0739:Dnah1	UTSW	14	31265915	nonsense	probably null
R0789:Dnah1	UTSW	14	31304591	missense	probably benign
R0826:Dnah1	UTSW	14	31303907	missense	probably benign	0.02
R1102:Dnah1	UTSW	14	31296457	nonsense	probably null
R1116:Dnah1	UTSW	14	31307867	missense	probably benign	0.13
R1229:Dnah1	UTSW	14	31310851	missense	probably benign	0.11
R1447:Dnah1	UTSW	14	31306898	missense	probably benign	0.06
R1449:Dnah1	UTSW	14	31263951	missense	probably damaging	1.00
R1462:Dnah1	UTSW	14	31268781	splice site	probably benign
R1482:Dnah1	UTSW	14	31294874	missense	probably damaging	1.00
R1500:Dnah1	UTSW	14	31316758	missense	probably benign
R1512:Dnah1	UTSW	14	31293037	missense	probably damaging	1.00
R1591:Dnah1	UTSW	14	31272332	missense	probably benign	0.01
R1598:Dnah1	UTSW	14	31301262	missense	probably benign	0.07
R1644:Dnah1	UTSW	14	31302292	splice site	probably benign
R1672:Dnah1	UTSW	14	31276200	missense	probably damaging	1.00
R1713:Dnah1	UTSW	14	31279182	missense	probably damaging	1.00
R1769:Dnah1	UTSW	14	31310882	missense	probably null	0.05
R1796:Dnah1	UTSW	14	31261093	missense	probably benign	0.00
R1902:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1903:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1905:Dnah1	UTSW	14	31264630	missense	probably benign	0.06
R1908:Dnah1	UTSW	14	31262558	missense	probably damaging	1.00
R1972:Dnah1	UTSW	14	31265391	nonsense	probably null
R1973:Dnah1	UTSW	14	31265391	nonsense	probably null
R2004:Dnah1	UTSW	14	31301856	missense	possibly damaging	0.79
R2051:Dnah1	UTSW	14	31279123	missense	probably damaging	1.00
R2062:Dnah1	UTSW	14	31271129	missense	probably damaging	1.00
R2188:Dnah1	UTSW	14	31279164	missense	probably damaging	0.98
R2240:Dnah1	UTSW	14	31299974	missense	probably benign	0.00
R2862:Dnah1	UTSW	14	31284762	missense	probably benign	0.21
R2894:Dnah1	UTSW	14	31298761	missense	possibly damaging	0.67
R3120:Dnah1	UTSW	14	31266822	nonsense	probably null
R3410:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3411:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3435:Dnah1	UTSW	14	31316674	missense	probably damaging	0.96
R3615:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3616:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3741:Dnah1	UTSW	14	31265467	splice site	probably benign
R3805:Dnah1	UTSW	14	31294763	missense	possibly damaging	0.67
R3894:Dnah1	UTSW	14	31307028	missense	probably benign
R4007:Dnah1	UTSW	14	31303784	splice site	probably benign
R4201:Dnah1	UTSW	14	31262270	missense	probably benign	0.00
R4232:Dnah1	UTSW	14	31304916	missense	probably benign
R4372:Dnah1	UTSW	14	31304922	missense	probably damaging	1.00
R4391:Dnah1	UTSW	14	31294835	missense	probably damaging	1.00
R4423:Dnah1	UTSW	14	31284761	missense	probably benign	0.00
R4526:Dnah1	UTSW	14	31285998	missense	probably benign	0.05
R4650:Dnah1	UTSW	14	31284887	splice site	probably null
R4723:Dnah1	UTSW	14	31272942	missense	probably damaging	1.00
R4748:Dnah1	UTSW	14	31319945	missense	probably benign
R4783:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4784:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4785:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4843:Dnah1	UTSW	14	31264963	missense	probably damaging	1.00
R4879:Dnah1	UTSW	14	31300748	missense	possibly damaging	0.91
R4897:Dnah1	UTSW	14	31267539	missense	probably damaging	1.00
R4911:Dnah1	UTSW	14	31295323	missense	probably damaging	1.00
R4985:Dnah1	UTSW	14	31286898	missense	probably null	1.00
R5070:Dnah1	UTSW	14	31282418	missense	probably benign	0.05
R5128:Dnah1	UTSW	14	31296195	splice site	probably null
R5409:Dnah1	UTSW	14	31263255	missense	probably damaging	1.00
R5436:Dnah1	UTSW	14	31316747	missense	probably benign
R5550:Dnah1	UTSW	14	31316708	missense	probably benign	0.00
R5555:Dnah1	UTSW	14	31290819	missense	probably damaging	0.99
R5566:Dnah1	UTSW	14	31274366	missense	probably benign	0.35
R5623:Dnah1	UTSW	14	31286023	missense	possibly damaging	0.62
R5701:Dnah1	UTSW	14	31274044	missense	probably damaging	1.00
R5751:Dnah1	UTSW	14	31310906	missense	probably benign	0.00
R5823:Dnah1	UTSW	14	31266418	missense	possibly damaging	0.92
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6090:Dnah1	UTSW	14	31269425	missense	possibly damaging	0.83
R6139:Dnah1	UTSW	14	31286027	missense	probably benign	0.02
R6145:Dnah1	UTSW	14	31300970	missense	probably benign	0.07
R6306:Dnah1	UTSW	14	31304587	missense	probably damaging	0.97
R6376:Dnah1	UTSW	14	31275608	missense	probably damaging	1.00
R6451:Dnah1	UTSW	14	31300808	missense	probably benign	0.08
R6549:Dnah1	UTSW	14	31269383	missense	probably damaging	1.00
R6748:Dnah1	UTSW	14	31299988	missense	probably damaging	0.99
R6826:Dnah1	UTSW	14	31286290	missense	probably benign	0.00
R6870:Dnah1	UTSW	14	31271061	nonsense	probably null
R6932:Dnah1	UTSW	14	31287776	missense	probably damaging	1.00
R6944:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R7033:Dnah1	UTSW	14	31264925	missense	probably damaging	1.00
R7078:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R7133:Dnah1	UTSW	14	31286076	missense	probably benign
R7136:Dnah1	UTSW	14	31298656	missense	probably damaging	1.00
R7203:Dnah1	UTSW	14	31274382	missense	probably benign
R7241:Dnah1	UTSW	14	31264939	missense	probably benign	0.00
R7260:Dnah1	UTSW	14	31269386	missense	probably damaging	1.00
R7264:Dnah1	UTSW	14	31269894	missense	probably benign
R7291:Dnah1	UTSW	14	31298705	missense	probably damaging	1.00
R7293:Dnah1	UTSW	14	31287863	missense	probably damaging	1.00
R7300:Dnah1	UTSW	14	31269841	missense	probably benign	0.05
R7319:Dnah1	UTSW	14	31296594	missense	probably benign	0.02
R7323:Dnah1	UTSW	14	31298707	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31261590	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31300791	missense	possibly damaging	0.80
R7499:Dnah1	UTSW	14	31315122	nonsense	probably null
R7526:Dnah1	UTSW	14	31287876	missense	possibly damaging	0.49
R7560:Dnah1	UTSW	14	31304983	missense	probably benign
R7574:Dnah1	UTSW	14	31319908	missense	probably benign	0.00
R7617:Dnah1	UTSW	14	31284782	missense	possibly damaging	0.80
R7620:Dnah1	UTSW	14	31303906	missense	possibly damaging	0.47
R7692:Dnah1	UTSW	14	31292338	missense	probably benign	0.00
R7702:Dnah1	UTSW	14	31310909	missense	probably benign
R7786:Dnah1	UTSW	14	31262521	missense	probably damaging	1.00
R7984:Dnah1	UTSW	14	31267815	missense	probably damaging	1.00
R8002:Dnah1	UTSW	14	31298722	missense	probably damaging	1.00
R8022:Dnah1	UTSW	14	31265014	missense	probably damaging	1.00
R8032:Dnah1	UTSW	14	31271548	missense	probably damaging	1.00
R8099:Dnah1	UTSW	14	31302364	missense	probably benign	0.00
R8171:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R8263:Dnah1	UTSW	14	31293177	missense	probably damaging	1.00
R8274:Dnah1	UTSW	14	31295574	missense	probably benign	0.00
R8345:Dnah1	UTSW	14	31264594	missense	probably damaging	1.00
R8348:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8353:Dnah1	UTSW	14	31283202	missense	probably benign
R8356:Dnah1	UTSW	14	31273015	missense	probably benign	0.00
R8376:Dnah1	UTSW	14	31301346	missense	probably damaging	1.00
R8448:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8461:Dnah1	UTSW	14	31305958	missense	probably benign	0.00
R8534:Dnah1	UTSW	14	31301848	missense	probably benign	0.16
R8544:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R8679:Dnah1	UTSW	14	31267810	missense	possibly damaging	0.77
R8716:Dnah1	UTSW	14	31267984	critical splice donor site	probably benign
R8750:Dnah1	UTSW	14	31304967	missense	probably benign	0.30
R8790:Dnah1	UTSW	14	31296275	missense	possibly damaging	0.89
R8808:Dnah1	UTSW	14	31286814	missense	probably benign
R8821:Dnah1	UTSW	14	31296498	missense	probably benign
R8887:Dnah1	UTSW	14	31311040	missense	probably damaging	1.00
R8948:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8950:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8955:Dnah1	UTSW	14	31285993	missense	probably benign
R8987:Dnah1	UTSW	14	31311747	missense	possibly damaging	0.93
R8998:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R8999:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R9015:Dnah1	UTSW	14	31264359	missense	probably damaging	0.96
R9031:Dnah1	UTSW	14	31279171	missense	probably benign
R9088:Dnah1	UTSW	14	31266013	missense	probably benign	0.04
R9096:Dnah1	UTSW	14	31261070	missense	probably damaging	0.99
R9117:Dnah1	UTSW	14	31311624	splice site	probably benign
R9157:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9296:Dnah1	UTSW	14	31274054	critical splice acceptor site	probably null
R9313:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9325:Dnah1	UTSW	14	31276203	missense	possibly damaging	0.69
R9352:Dnah1	UTSW	14	31316663	missense	probably benign	0.00
R9411:Dnah1	UTSW	14	31296299	missense	probably damaging	1.00
R9429:Dnah1	UTSW	14	31275542	nonsense	probably null
R9452:Dnah1	UTSW	14	31296491	missense	probably benign	0.35
R9562:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9565:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9616:Dnah1	UTSW	14	31304443	missense	probably null	0.20
R9621:Dnah1	UTSW	14	31294815	missense	probably damaging	1.00
R9677:Dnah1	UTSW	14	31307864	missense	probably benign	0.00
R9723:Dnah1	UTSW	14	31265989	missense	probably damaging	1.00
R9758:Dnah1	UTSW	14	31263438	missense	probably damaging	0.98
RF006:Dnah1	UTSW	14	31307875	missense	probably benign	0.08
Z1088:Dnah1	UTSW	14	31304811	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ACAAAATTTCTTGGCATCCGG -3'
(R):5'- CGGTTTGAGTCTGTCACATATAAAC -3'

Sequencing Primer
(F):5'- GCACAGAGAATACCAGGTTTATG -3'
(R):5'- TCCTGGAGCATCTTAGCT -3'

Posted On

2016-10-06