Incidental Mutation 'R0490:Rita1'
ID43435
Institutional Source Beutler Lab
Gene Symbol Rita1
Ensembl Gene ENSMUSG00000029600
Gene NameRBPJ interacting and tubulin associated 1
Synonyms1110008J03Rik
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R0490 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120594305-120612589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120611565 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 28 (F28I)
Ref Sequence ENSEMBL: ENSMUSP00000136946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598] [ENSMUST00000031599] [ENSMUST00000069259] [ENSMUST00000094391] [ENSMUST00000111884] [ENSMUST00000140554] [ENSMUST00000156356] [ENSMUST00000177800]
Predicted Effect probably benign
Transcript: ENSMUST00000031598
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000031599
AA Change: F28I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031599
Gene: ENSMUSG00000029600
AA Change: F28I

DomainStartEndE-ValueType
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069259
SMART Domains Protein: ENSMUSP00000069167
Gene: ENSMUSG00000029601

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 298 348 N/A INTRINSIC
IQ 363 385 5.53e-4 SMART
low complexity region 387 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094391
SMART Domains Protein: ENSMUSP00000091955
Gene: ENSMUSG00000029601

DomainStartEndE-ValueType
coiled coil region 97 137 N/A INTRINSIC
coiled coil region 209 257 N/A INTRINSIC
coiled coil region 331 381 N/A INTRINSIC
IQ 396 418 5.53e-4 SMART
low complexity region 420 458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111884
AA Change: F28I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136070
Predicted Effect probably damaging
Transcript: ENSMUST00000140554
AA Change: F28I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000156356
AA Change: F25I

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122910
Gene: ENSMUSG00000029600
AA Change: F25I

DomainStartEndE-ValueType
low complexity region 81 91 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177800
AA Change: F28I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136946
Gene: ENSMUSG00000029600
AA Change: F28I

DomainStartEndE-ValueType
Pfam:RITA 1 253 2.5e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202672
Meta Mutation Damage Score 0.1968 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Ap4e1 T A 2: 127,046,186 N404K probably damaging Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Fxn A G 19: 24,277,179 probably null Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Lpl A G 8: 68,896,691 R290G probably damaging Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Notch4 T A 17: 34,582,890 D1237E probably damaging Het
Olfr1373 A G 11: 52,144,666 I288T probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Slc1a1 A G 19: 28,897,531 K170E probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Rita1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02269:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02273:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02274:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02302:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02313:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02315:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02326:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02329:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02330:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02331:Rita1 APN 5 120609793 missense probably damaging 0.98
IGL02750:Rita1 APN 5 120609651 missense possibly damaging 0.58
R0360:Rita1 UTSW 5 120609772 missense probably benign 0.02
R1822:Rita1 UTSW 5 120609580 missense possibly damaging 0.50
R2440:Rita1 UTSW 5 120609939 missense probably damaging 1.00
R4429:Rita1 UTSW 5 120609561 missense probably damaging 0.97
R4870:Rita1 UTSW 5 120611383 missense probably damaging 1.00
R5009:Rita1 UTSW 5 120611383 missense probably damaging 1.00
R5941:Rita1 UTSW 5 120609561 missense probably benign 0.35
R6475:Rita1 UTSW 5 120611570 missense probably damaging 1.00
R7749:Rita1 UTSW 5 120611441 missense probably benign 0.23
R8313:Rita1 UTSW 5 120609651 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCCATACCTACGATAGACCTTCCC -3'
(R):5'- AGCTGATTGCTCATTCCGACCC -3'

Sequencing Primer
(F):5'- accaaccatctccacccc -3'
(R):5'- TCCGACCCCTATTACAGGGAG -3'
Posted On2013-05-23