Incidental Mutation 'R5481:Slc22a30'
ID434364
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission 043042-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5481 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8336837 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 495 (N495S)
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269]
Predicted Effect probably benign
Transcript: ENSMUST00000064507
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
AA Change: N495S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562
AA Change: N495S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.6%
  • 10x: 95.1%
  • 20x: 90.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,562 S187P probably damaging Het
Aass C A 6: 23,113,476 V282L probably benign Het
Adh6a G T 3: 138,325,958 V204F probably damaging Het
Aspm A G 1: 139,457,061 K148E possibly damaging Het
Atp12a A T 14: 56,373,389 D330V possibly damaging Het
Barhl1 A G 2: 28,915,340 Y114H probably damaging Het
BC106179 T A 16: 23,224,168 probably benign Het
Cabin1 A G 10: 75,735,066 L792P probably benign Het
Calcoco2 A G 11: 96,107,543 V18A probably damaging Het
Chpf2 A T 5: 24,589,342 H170L probably damaging Het
Chrna1 T A 2: 73,566,926 I340F possibly damaging Het
Ckap5 A T 2: 91,572,447 I690F possibly damaging Het
Col10a1 A G 10: 34,395,664 H544R probably benign Het
Cyp2b19 A C 7: 26,766,821 T350P probably damaging Het
Dgkq A G 5: 108,648,810 probably null Het
Dnah1 A G 14: 31,308,871 V443A possibly damaging Het
Erbb3 T C 10: 128,572,480 D855G probably damaging Het
Fam3c T C 6: 22,321,358 D138G probably benign Het
Fen1 A G 19: 10,200,658 C141R probably damaging Het
Flnc G A 6: 29,441,217 G390D probably damaging Het
Fnip1 C A 11: 54,502,644 D635E probably benign Het
Fry A T 5: 150,260,319 L17F probably benign Het
Fsip2 T C 2: 82,979,886 I2183T probably benign Het
Gfpt1 T A 6: 87,050,969 I19N probably damaging Het
Gm9774 A G 3: 92,429,351 S15P possibly damaging Het
Hus1b T C 13: 30,946,959 D239G probably benign Het
Kif1a T C 1: 93,060,244 K546R probably benign Het
Kmt2d A G 15: 98,862,005 V1124A unknown Het
Krtap16-1 A G 11: 99,985,327 I417T probably damaging Het
Manba A T 3: 135,524,556 N297Y possibly damaging Het
Mblac1 A G 5: 138,194,816 D140G probably damaging Het
Mlh1 T C 9: 111,229,837 probably null Het
Morc1 T A 16: 48,561,485 probably null Het
Morc3 C A 16: 93,862,655 P449Q probably damaging Het
Mtr T C 13: 12,188,155 probably null Het
Mylk T A 16: 34,921,604 C829S probably benign Het
Myo1d A G 11: 80,663,095 I520T possibly damaging Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nos1 A T 5: 117,867,754 I180F probably benign Het
Ntsr1 C T 2: 180,541,520 T341M possibly damaging Het
Olfr916 A T 9: 38,657,620 F257L probably benign Het
P2rx7 A G 5: 122,680,820 D435G possibly damaging Het
Peli2 C A 14: 48,252,633 N136K probably damaging Het
Pigt C A 2: 164,506,422 P429H probably damaging Het
Pik3r2 T C 8: 70,769,764 I515V probably benign Het
Pkhd1l1 A G 15: 44,558,646 Y3104C probably damaging Het
Ppp1r16a A C 15: 76,691,021 E43A probably damaging Het
Ptpn18 T C 1: 34,471,663 L260P possibly damaging Het
Scaf11 A T 15: 96,420,617 S355R probably damaging Het
Sema4a A T 3: 88,453,040 Y77* probably null Het
Serpinb9b T C 13: 33,038,093 V230A possibly damaging Het
Sfswap T A 5: 129,514,818 S300T probably damaging Het
Srcap G A 7: 127,532,197 G836D probably damaging Het
Stard4 A C 18: 33,205,245 C137W probably benign Het
Stat6 A G 10: 127,647,826 probably null Het
Steap3 T C 1: 120,241,724 D243G probably benign Het
Taf1c A G 8: 119,599,240 S628P probably damaging Het
Unkl C T 17: 25,201,172 Q13* probably null Het
Usp38 A G 8: 80,993,323 S426P possibly damaging Het
Vmn2r8 T C 5: 108,801,770 T404A probably benign Het
Washc1 T C 17: 66,118,865 V425A probably benign Het
Zfyve9 A G 4: 108,644,349 I590T probably damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8404540 nonsense probably null
R8248:Slc22a30 UTSW 19 8370199 missense probably benign 0.12
R8677:Slc22a30 UTSW 19 8386671 missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8386390 critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8337976 missense probably damaging 1.00
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCAGCATAGTCCATTAGC -3'
(R):5'- AAGTGTCTTCATGGTCTGAATCTG -3'

Sequencing Primer
(F):5'- GCATAGTCCATTAGCAAACAACTC -3'
(R):5'- AGGAAGAGTAAGTTACCAAGATCC -3'
Posted On2016-10-06