Incidental Mutation 'R5482:Ttll11'
ID434368
Institutional Source Beutler Lab
Gene Symbol Ttll11
Ensembl Gene ENSMUSG00000026885
Gene Nametubulin tyrosine ligase-like family, member 11
Synonyms4932702F08Rik, 4933424A20Rik, D2Ertd624e
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location35751241-35979913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35752406 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 638 (S638P)
Ref Sequence ENSEMBL: ENSMUSP00000108600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028248] [ENSMUST00000112976] [ENSMUST00000161970]
Predicted Effect probably damaging
Transcript: ENSMUST00000028248
AA Change: S671P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028248
Gene: ENSMUSG00000026885
AA Change: S671P

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 9.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112976
AA Change: S638P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108600
Gene: ENSMUSG00000026885
AA Change: S638P

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 5.9e-68 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000160906
AA Change: S454P
SMART Domains Protein: ENSMUSP00000125511
Gene: ENSMUSG00000026885
AA Change: S454P

DomainStartEndE-ValueType
Pfam:TTL 1 304 4.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161970
SMART Domains Protein: ENSMUSP00000125627
Gene: ENSMUSG00000026885

DomainStartEndE-ValueType
SCOP:d1gosa1 33 88 5e-3 SMART
low complexity region 107 122 N/A INTRINSIC
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Ttll11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ttll11 APN 2 35902720 nonsense probably null
IGL01148:Ttll11 APN 2 35784193 missense probably damaging 0.96
IGL02933:Ttll11 APN 2 35979410 missense probably benign
e-suppressor UTSW 2 35752406 missense probably damaging 1.00
R0356:Ttll11 UTSW 2 35902676 missense possibly damaging 0.66
R0494:Ttll11 UTSW 2 35944874 missense probably damaging 1.00
R1494:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1630:Ttll11 UTSW 2 35889325 missense probably damaging 0.96
R1688:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1939:Ttll11 UTSW 2 35940753 missense probably null
R2414:Ttll11 UTSW 2 35979534 missense unknown
R2986:Ttll11 UTSW 2 35817738 missense probably benign 0.00
R4295:Ttll11 UTSW 2 35979552 small deletion probably benign
R4346:Ttll11 UTSW 2 35784118 missense probably benign 0.22
R5234:Ttll11 UTSW 2 35940733 missense probably damaging 1.00
R5340:Ttll11 UTSW 2 35902789 missense probably damaging 0.99
R5442:Ttll11 UTSW 2 35903123 makesense probably null
R5604:Ttll11 UTSW 2 35817786 missense probably benign 0.07
R6219:Ttll11 UTSW 2 35752499 splice site probably null
R6481:Ttll11 UTSW 2 35902754 missense probably damaging 1.00
R6764:Ttll11 UTSW 2 35890448 splice site probably null
R6944:Ttll11 UTSW 2 35752294 missense probably benign 0.05
R7224:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R7511:Ttll11 UTSW 2 35903034 missense probably damaging 1.00
R8030:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R8052:Ttll11 UTSW 2 35979515 missense unknown
R8200:Ttll11 UTSW 2 35944928 missense probably damaging 1.00
R8332:Ttll11 UTSW 2 35940709 missense possibly damaging 0.85
X0026:Ttll11 UTSW 2 35795352 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGGATTGAGAGAGCTTGCTAG -3'
(R):5'- AAGATCCTCTGTGTGCTGGC -3'

Sequencing Primer
(F):5'- GCTAGCCCCGATTACTCG -3'
(R):5'- CTTCCTGCGTGAGGTACAG -3'
Posted On2016-10-06