Mutagenetix > Incidental Mutation

Incidental Mutation 'R0490:Cntn6'

43437

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

038688-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R0490 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104833918 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 641 (V641A)

Ref Sequence

ENSEMBL: ENSMUSP00000124025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089215
AA Change: V641A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: V641A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161070
AA Change: V569A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: V569A

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162872
AA Change: V641A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: V641A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Meta Mutation Damage Score

0.0955

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.2%
20x: 92.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330159F19Rik	T	A	10: 29,227,342	Y640N	probably damaging	Het
Adamts9	T	A	6: 92,872,866	Q402L	probably benign	Het
Als2cl	A	G	9: 110,895,346	T750A	probably benign	Het
Ank1	C	A	8: 23,107,874		probably benign	Het
Ap4e1	T	A	2: 127,046,186	N404K	probably damaging	Het
Atf7ip	G	T	6: 136,609,192		probably benign	Het
Bean1	A	T	8: 104,215,028	T169S	possibly damaging	Het
Bod1l	G	T	5: 41,821,892	T693N	probably damaging	Het
Ccdc81	A	T	7: 89,887,762	V226D	probably benign	Het
Cd48	A	G	1: 171,704,877	*241W	probably null	Het
Cdon	C	A	9: 35,452,682	S32Y	probably damaging	Het
Cers3	A	G	7: 66,773,690	S128G	possibly damaging	Het
Col6a4	G	A	9: 106,013,770	T1775I	probably damaging	Het
Dnah8	T	C	17: 30,700,419	V1122A	probably benign	Het
Dst	G	T	1: 34,307,368	G5102*	probably null	Het
Dvl3	C	T	16: 20,527,423		probably benign	Het
Epha5	G	T	5: 84,107,974		probably benign	Het
Fscb	G	A	12: 64,472,887	P602S	unknown	Het
Fxn	A	G	19: 24,277,179		probably null	Het
Gipc2	A	G	3: 152,102,654	L254P	possibly damaging	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Gng8	A	G	7: 16,894,983	T14A	probably benign	Het
Gsdmc3	C	T	15: 63,860,250	G309D	possibly damaging	Het
Gsr	T	A	8: 33,671,512		probably benign	Het
Gtdc1	A	T	2: 44,635,040	D152E	probably benign	Het
Herc1	A	G	9: 66,484,999	D4063G	probably damaging	Het
Hsdl2	C	T	4: 59,612,814		probably benign	Het
Iqgap3	T	C	3: 88,114,056		probably benign	Het
Kcnj10	A	G	1: 172,369,452	T178A	probably damaging	Het
Lama5	T	A	2: 180,180,169	I2958F	possibly damaging	Het
Lnx1	T	A	5: 74,620,347		probably null	Het
Lpl	A	G	8: 68,896,691	R290G	probably damaging	Het
Mamdc4	C	T	2: 25,563,581	R1196K	probably benign	Het
Mogat2	T	C	7: 99,223,144	S167G	probably benign	Het
Nek8	T	A	11: 78,167,729	I582F	probably benign	Het
Notch4	T	A	17: 34,582,890	D1237E	probably damaging	Het
Olfr1373	A	G	11: 52,144,666	I288T	probably damaging	Het
Olfr1457	A	G	19: 13,094,812	Y279H	probably damaging	Het
Olfr1475	G	A	19: 13,479,493	A235V	probably damaging	Het
Olfr1499	A	G	19: 13,814,855	L245P	probably damaging	Het
Pcdhb8	T	C	18: 37,356,780	S504P	probably damaging	Het
Pigs	T	C	11: 78,335,625	S223P	probably damaging	Het
Prkch	A	G	12: 73,759,676	I566V	probably damaging	Het
Ptpn22	T	C	3: 103,886,179	S549P	probably damaging	Het
Rita1	A	T	5: 120,611,565	F28I	probably damaging	Het
Rpgrip1l	A	T	8: 91,299,845		probably benign	Het
Slc1a1	A	G	19: 28,897,531	K170E	probably benign	Het
Spag17	C	T	3: 99,982,411	R199W	probably damaging	Het
Tas2r116	T	C	6: 132,856,021	V195A	probably benign	Het
Trav7d-3	C	A	14: 52,744,550		probably benign	Het
Trim15	T	C	17: 36,866,355	K138E	probably benign	Het
Ttn	T	A	2: 76,708,830	H34604L	probably benign	Het
Ttn	C	T	2: 76,747,532	R16012K	probably damaging	Het
Zfp948	T	C	17: 21,588,034	V496A	probably benign	Het
Zfy2	A	T	Y: 2,106,620	S671R	possibly damaging	Het
Zswim1	T	A	2: 164,825,283	Y152N	possibly damaging	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
R9698:Cntn6	UTSW	6	104833083	nonsense	probably null
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGTGCTTAGCAAATAGTTCCAGTTCCT -3'
(R):5'- agaaatcttcagttttGGCGTGAGGTC -3'

Sequencing Primer
(F):5'- CTTGAGCTACATTTGTAGAGAGACTG -3'
(R):5'- GACAAATCTCCTTGGCCACTTAC -3'

Posted On

2013-05-23