Incidental Mutation 'R5482:Skint2'
ID434372
Institutional Source Beutler Lab
Gene Symbol Skint2
Ensembl Gene ENSMUSG00000034359
Gene Nameselection and upkeep of intraepithelial T cells 2
SynonymsB7S3, OTTMUSG00000008540
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112557194-112652248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112625879 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 160 (C160W)
Ref Sequence ENSEMBL: ENSMUSP00000139831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058791] [ENSMUST00000106560] [ENSMUST00000186969]
Predicted Effect probably damaging
Transcript: ENSMUST00000058791
AA Change: C160W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061011
Gene: ENSMUSG00000034359
AA Change: C160W

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 140 225 2.7e-10 PFAM
Pfam:Ig_2 153 231 3.6e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106559
SMART Domains Protein: ENSMUSP00000102169
Gene: ENSMUSG00000034359

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 146 225 5.2e-8 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106560
AA Change: C160W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102170
Gene: ENSMUSG00000034359
AA Change: C160W

DomainStartEndE-ValueType
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 1.3e-10 PFAM
Pfam:Ig_2 153 231 2e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186969
AA Change: C160W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139831
Gene: ENSMUSG00000034359
AA Change: C160W

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 2e-10 PFAM
Pfam:Ig_2 154 231 1.7e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 322 344 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Skint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Skint2 APN 4 112624212 missense probably damaging 1.00
IGL00801:Skint2 APN 4 112625991 missense possibly damaging 0.88
IGL01602:Skint2 APN 4 112625994 missense probably benign 0.44
IGL01605:Skint2 APN 4 112625994 missense probably benign 0.44
IGL02015:Skint2 APN 4 112624128 nonsense probably null
IGL02694:Skint2 APN 4 112616595 splice site probably benign
IGL03247:Skint2 APN 4 112626026 missense probably benign 0.06
PIT4677001:Skint2 UTSW 4 112625938 missense probably benign 0.10
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0190:Skint2 UTSW 4 112616532 missense possibly damaging 0.85
R0479:Skint2 UTSW 4 112624041 missense possibly damaging 0.47
R0625:Skint2 UTSW 4 112624086 missense probably damaging 1.00
R1143:Skint2 UTSW 4 112625936 missense probably benign 0.00
R1564:Skint2 UTSW 4 112625998 missense probably damaging 1.00
R1861:Skint2 UTSW 4 112647118 intron probably benign
R1864:Skint2 UTSW 4 112625909 missense probably benign 0.10
R3079:Skint2 UTSW 4 112639673 missense probably benign 0.01
R3891:Skint2 UTSW 4 112624186 missense probably damaging 1.00
R4422:Skint2 UTSW 4 112584588 intron probably benign
R4799:Skint2 UTSW 4 112652108 missense probably benign 0.07
R5458:Skint2 UTSW 4 112624180 missense possibly damaging 0.83
R5603:Skint2 UTSW 4 112649764 missense possibly damaging 0.91
R7068:Skint2 UTSW 4 112624351 missense probably damaging 1.00
R7233:Skint2 UTSW 4 112625925 missense probably damaging 0.99
R7335:Skint2 UTSW 4 112624218 missense probably damaging 1.00
R7516:Skint2 UTSW 4 112625971 missense probably damaging 1.00
R7790:Skint2 UTSW 4 112616554 missense possibly damaging 0.71
R7878:Skint2 UTSW 4 112649745 missense possibly damaging 0.85
R7941:Skint2 UTSW 4 112625990 missense probably damaging 1.00
R7965:Skint2 UTSW 4 112645451 missense probably benign 0.17
R7976:Skint2 UTSW 4 112624132 missense probably damaging 1.00
R8100:Skint2 UTSW 4 112626000 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAAAATTTCTGCCTGGCTCAC -3'
(R):5'- TGAAGATAGCAAGTGATACTCCTG -3'

Sequencing Primer
(F):5'- AACCAGGGTCCTGTAGACTTTTTGAC -3'
(R):5'- CTGTGGGAGCTGGCTTCAATAAG -3'
Posted On2016-10-06