Mutagenetix > Incidental Mutations

Incidental Mutation 'R5482:Cfap57'

434373

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

043043-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5482 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 118569641 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1067 (G1067R)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

Predicted Effect

probably benign
Transcript: ENSMUST00000071972
AA Change: G1067R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: G1067R

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921
AA Change: G1067R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: G1067R

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.4%
10x: 94.5%
20x: 87.6%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	A	T	8: 36,512,049	M269L	probably benign	Het
9230109A22Rik	T	C	15: 25,138,950		noncoding transcript	Het
Abca15	T	C	7: 120,369,147	L801P	probably damaging	Het
Acap3	A	G	4: 155,900,156	D212G	probably benign	Het
Acsl6	G	A	11: 54,327,138	D166N	probably damaging	Het
Acy1	T	C	9: 106,434,639		probably benign	Het
Adgrl3	A	G	5: 81,794,513	N1368S	probably damaging	Het
Akap5	T	C	12: 76,328,826	I344T	probably benign	Het
Aplp1	A	G	7: 30,440,175	F399S	probably damaging	Het
Arap3	A	G	18: 37,974,674	S1302P	possibly damaging	Het
Bik	T	G	15: 83,544,134	V121G	probably damaging	Het
Birc6	A	T	17: 74,641,782	M3069L	possibly damaging	Het
Birc6	A	G	17: 74,662,690	T4237A	probably damaging	Het
Btn2a2	T	C	13: 23,486,387	N59D	probably benign	Het
Cabyr	A	G	18: 12,751,439	S328G	possibly damaging	Het
Cryl1	A	T	14: 57,313,012	F132I	probably damaging	Het
Dnah8	G	A	17: 30,800,547	E3865K	probably damaging	Het
Dock3	G	A	9: 106,978,738	R741*	probably null	Het
Fam57b	A	G	7: 126,827,488	T78A	possibly damaging	Het
Fam69a	C	G	5: 107,909,663	C343S	probably damaging	Het
Fsip2	C	T	2: 82,985,310	L3796F	possibly damaging	Het
Gm10722	A	C	9: 3,001,041	Y39S	probably benign	Het
Gm5535	C	A	2: 144,174,572		noncoding transcript	Het
Gmcl1	A	T	6: 86,718,073	M202K	probably damaging	Het
Hecw2	T	A	1: 53,926,201	M489L	probably benign	Het
Lrrk1	A	G	7: 66,330,670	I254T	probably benign	Het
Lrrn3	G	A	12: 41,452,387	L644F	probably benign	Het
Lrrn3	A	C	12: 41,452,388	C643W	probably damaging	Het
Nr2f6	A	T	8: 71,374,538	I373N	probably damaging	Het
Nt5dc3	A	G	10: 86,811,531	Y130C	probably damaging	Het
Olfr1448	T	C	19: 12,919,905	T135A	probably damaging	Het
Olfr788	T	C	10: 129,473,078	Y129H	probably benign	Het
Otogl	T	A	10: 107,821,941	I1043F	probably damaging	Het
Padi3	G	A	4: 140,795,843	T302I	probably damaging	Het
Pcdhgb5	A	G	18: 37,731,532	N127D	probably damaging	Het
Pign	A	G	1: 105,546,710	F876L	probably benign	Het
Pip5k1c	A	G	10: 81,293,063	E2G	probably damaging	Het
Ppp1r18	G	A	17: 35,873,879	E141K	probably damaging	Het
Ralbp1	A	C	17: 65,861,568	Y247*	probably null	Het
Ripply2	A	G	9: 87,015,567	E8G	possibly damaging	Het
Rufy3	TAAGCA	TA	5: 88,637,332		probably null	Het
Skint2	T	G	4: 112,625,879	C160W	probably damaging	Het
Sun2	C	T	15: 79,737,511	R172Q	probably benign	Het
Syna	A	G	5: 134,559,174	L307P	possibly damaging	Het
Trappc12	T	C	12: 28,691,325	K795R	probably damaging	Het
Ttll11	A	G	2: 35,752,406	S638P	probably damaging	Het
Usp2	G	A	9: 44,089,183		probably null	Het
Vmn2r26	A	T	6: 124,061,326	E620V	possibly damaging	Het
Wdr36	A	T	18: 32,841,904	H103L	probably benign	Het
Wnt5b	T	C	6: 119,446,431	T78A	probably benign	Het
Zc2hc1b	C	T	10: 13,153,526	R146Q	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTTCAACCCTGCAATCTCC -3'
(R):5'- CATCTAGGTTTCTGTGCCCAG -3'

Sequencing Primer
(F):5'- TGCAATCTCCACCTGGCG -3'
(R):5'- CAGTCAGGTGTTCATCCCAGATG -3'

Posted On

2016-10-06