Incidental Mutation 'R5482:Acap3'
ID434375
Institutional Source Beutler Lab
Gene Symbol Acap3
Ensembl Gene ENSMUSG00000029033
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 3
SynonymsCentb5, Kiaa1716-hp
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5482 (G1)
Quality Score82
Status Validated
Chromosome4
Chromosomal Location155891822-155907251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155900156 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 212 (D212G)
Ref Sequence ENSEMBL: ENSMUSP00000101209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079031] [ENSMUST00000105584]
Predicted Effect probably benign
Transcript: ENSMUST00000079031
AA Change: D212G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033
AA Change: D212G

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105584
AA Change: D212G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033
AA Change: D212G

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145654
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Acap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Acap3 APN 4 155902219 missense probably damaging 0.99
IGL01815:Acap3 APN 4 155902187 missense probably damaging 1.00
IGL02104:Acap3 APN 4 155905085 missense probably damaging 1.00
IGL02387:Acap3 APN 4 155902160 missense probably damaging 1.00
IGL02544:Acap3 APN 4 155892410 missense possibly damaging 0.93
IGL03124:Acap3 APN 4 155905033 missense probably benign 0.00
IGL03052:Acap3 UTSW 4 155903358 missense probably damaging 1.00
PIT4514001:Acap3 UTSW 4 155903378 missense probably benign 0.00
R0207:Acap3 UTSW 4 155899424 missense probably damaging 1.00
R0452:Acap3 UTSW 4 155902328 nonsense probably null
R1110:Acap3 UTSW 4 155905399 splice site probably null
R1387:Acap3 UTSW 4 155899480 missense probably benign 0.06
R1475:Acap3 UTSW 4 155902821 missense probably damaging 1.00
R1535:Acap3 UTSW 4 155896174 splice site probably benign
R2136:Acap3 UTSW 4 155896912 missense probably damaging 1.00
R2149:Acap3 UTSW 4 155905625 missense probably damaging 1.00
R2218:Acap3 UTSW 4 155903862 splice site probably null
R2897:Acap3 UTSW 4 155904931 splice site probably null
R2898:Acap3 UTSW 4 155903459 missense possibly damaging 0.88
R2898:Acap3 UTSW 4 155904931 splice site probably null
R3008:Acap3 UTSW 4 155905682 missense probably benign 0.37
R4170:Acap3 UTSW 4 155900001 missense possibly damaging 0.85
R4193:Acap3 UTSW 4 155901777 missense probably benign 0.07
R4822:Acap3 UTSW 4 155902451 intron probably benign
R4882:Acap3 UTSW 4 155905655 missense probably damaging 0.99
R5655:Acap3 UTSW 4 155896619 missense probably benign 0.22
R5769:Acap3 UTSW 4 155902400 missense probably damaging 0.99
R5943:Acap3 UTSW 4 155899422 missense possibly damaging 0.78
R6236:Acap3 UTSW 4 155905207 missense possibly damaging 0.91
R6259:Acap3 UTSW 4 155896118 missense possibly damaging 0.91
R6790:Acap3 UTSW 4 155902991 missense probably damaging 1.00
R7000:Acap3 UTSW 4 155903849 missense possibly damaging 0.79
R7352:Acap3 UTSW 4 155905711 missense possibly damaging 0.56
R7442:Acap3 UTSW 4 155905621 missense probably damaging 0.98
RF008:Acap3 UTSW 4 155905098 small insertion probably benign
RF010:Acap3 UTSW 4 155905096 small insertion probably benign
RF013:Acap3 UTSW 4 155905096 small insertion probably benign
RF022:Acap3 UTSW 4 155905096 small insertion probably benign
RF025:Acap3 UTSW 4 155905102 small insertion probably benign
RF028:Acap3 UTSW 4 155905091 small insertion probably benign
RF032:Acap3 UTSW 4 155905102 small insertion probably benign
RF034:Acap3 UTSW 4 155905092 small insertion probably benign
RF035:Acap3 UTSW 4 155905091 small insertion probably benign
RF036:Acap3 UTSW 4 155905087 small insertion probably benign
RF038:Acap3 UTSW 4 155905092 small insertion probably benign
RF039:Acap3 UTSW 4 155905092 small insertion probably benign
RF041:Acap3 UTSW 4 155905100 small insertion probably benign
RF064:Acap3 UTSW 4 155905100 small insertion probably benign
Z1176:Acap3 UTSW 4 155905179 missense probably damaging 1.00
Z1177:Acap3 UTSW 4 155905518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCCTGACACCTGCTATG -3'
(R):5'- CGCTTTTCCACTGCAGAGTC -3'

Sequencing Primer
(F):5'- TGGCAGATCAATGTCCTCCAG -3'
(R):5'- AGTCGATCACAAGCTGGTC -3'
Posted On2016-10-06