Incidental Mutation 'R5482:Wnt5b'
ID434383
Institutional Source Beutler Lab
Gene Symbol Wnt5b
Ensembl Gene ENSMUSG00000030170
Gene Namewingless-type MMTV integration site family, member 5B
SynonymsWnt-5b
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119432531-119544347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119446431 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 78 (T78A)
Ref Sequence ENSEMBL: ENSMUSP00000137065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117171] [ENSMUST00000118120] [ENSMUST00000119369] [ENSMUST00000178696]
Predicted Effect probably benign
Transcript: ENSMUST00000117171
AA Change: T78A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113188
Gene: ENSMUSG00000030170
AA Change: T78A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118120
AA Change: T40A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112819
Gene: ENSMUSG00000030170
AA Change: T40A

DomainStartEndE-ValueType
WNT1 12 321 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119369
AA Change: T91A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112448
Gene: ENSMUSG00000030170
AA Change: T91A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
WNT1 63 372 3.47e-215 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178696
AA Change: T78A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137065
Gene: ENSMUSG00000030170
AA Change: T78A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
WNT1 50 359 3.47e-215 SMART
Meta Mutation Damage Score 0.1375 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal numbers of thoracic motor neurons and proportions of motor columnar subtypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Wnt5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Wnt5b APN 6 119440554 missense possibly damaging 0.70
IGL01822:Wnt5b APN 6 119433472 missense probably damaging 1.00
Blizzard UTSW 6 119446358 missense probably damaging 1.00
Invierno UTSW 6 119440311 missense probably damaging 1.00
luftmensch UTSW 6 119433852 missense probably damaging 0.97
R0557:Wnt5b UTSW 6 119433818 missense probably damaging 1.00
R0732:Wnt5b UTSW 6 119446582 nonsense probably null
R1472:Wnt5b UTSW 6 119433481 missense probably damaging 1.00
R1673:Wnt5b UTSW 6 119446354 missense probably benign 0.19
R4202:Wnt5b UTSW 6 119440311 missense probably damaging 1.00
R5100:Wnt5b UTSW 6 119440488 missense probably benign 0.20
R5264:Wnt5b UTSW 6 119433852 missense probably damaging 0.97
R5393:Wnt5b UTSW 6 119440433 missense probably damaging 1.00
R5394:Wnt5b UTSW 6 119440322 missense probably damaging 0.98
R5741:Wnt5b UTSW 6 119433729 missense probably damaging 1.00
R5902:Wnt5b UTSW 6 119448238 missense probably benign 0.00
R6005:Wnt5b UTSW 6 119433654 missense probably benign 0.04
R6061:Wnt5b UTSW 6 119433642 missense probably damaging 0.98
R6208:Wnt5b UTSW 6 119446512 missense probably damaging 1.00
R6405:Wnt5b UTSW 6 119433496 missense probably benign 0.06
R6478:Wnt5b UTSW 6 119433790 missense probably damaging 1.00
R6482:Wnt5b UTSW 6 119433612 missense possibly damaging 0.88
R7047:Wnt5b UTSW 6 119448256 start gained probably benign
R7338:Wnt5b UTSW 6 119448131 splice site probably null
R8044:Wnt5b UTSW 6 119446358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGCCTAGGAAGAATGC -3'
(R):5'- ACCCATGAGTGCATTCACAGC -3'

Sequencing Primer
(F):5'- AAGAATGCAGTGTGGGCTTTC -3'
(R):5'- AGTGCATTCACAGCCGTGC -3'
Posted On2016-10-06