Incidental Mutation 'R5482:Usp2'
ID434391
Institutional Source Beutler Lab
Gene Symbol Usp2
Ensembl Gene ENSMUSG00000032010
Gene Nameubiquitin specific peptidase 2
Synonymsubp41, B930035K21Rik
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44067021-44095627 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 44089183 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034508] [ENSMUST00000065461] [ENSMUST00000065461] [ENSMUST00000114830] [ENSMUST00000162126] [ENSMUST00000175816] [ENSMUST00000176416] [ENSMUST00000176416] [ENSMUST00000177054] [ENSMUST00000185479]
Predicted Effect probably null
Transcript: ENSMUST00000034508
SMART Domains Protein: ENSMUSP00000034508
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 8.4e-75 PFAM
Pfam:UCH_1 281 592 3.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065461
SMART Domains Protein: ENSMUSP00000070264
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 57 387 7.5e-79 PFAM
Pfam:UCH_1 58 369 2.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000065461
SMART Domains Protein: ENSMUSP00000070264
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 57 387 7.5e-79 PFAM
Pfam:UCH_1 58 369 2.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114830
SMART Domains Protein: ENSMUSP00000110479
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176022
Predicted Effect probably null
Transcript: ENSMUST00000176416
SMART Domains Protein: ENSMUSP00000135482
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 54 384 7.3e-79 PFAM
Pfam:UCH_1 55 366 2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176416
SMART Domains Protein: ENSMUSP00000135482
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 54 384 7.3e-79 PFAM
Pfam:UCH_1 55 366 2e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177054
SMART Domains Protein: ENSMUSP00000135018
Gene: ENSMUSG00000032010

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177422
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null mutation display severely reduced male fertility with defects in sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Usp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Usp2 APN 9 44089165 nonsense probably null
IGL01574:Usp2 APN 9 44093803 missense probably damaging 1.00
IGL02103:Usp2 APN 9 44089128 intron probably benign
IGL02391:Usp2 APN 9 44091227 missense probably damaging 1.00
R0385:Usp2 UTSW 9 44092750 missense probably damaging 0.99
R0555:Usp2 UTSW 9 44092784 missense probably damaging 1.00
R0614:Usp2 UTSW 9 44092492 nonsense probably null
R1553:Usp2 UTSW 9 44092155 missense probably damaging 0.99
R1851:Usp2 UTSW 9 44075966 missense probably benign 0.00
R2437:Usp2 UTSW 9 44092148 missense probably damaging 0.98
R3962:Usp2 UTSW 9 44075657 missense possibly damaging 0.82
R4392:Usp2 UTSW 9 44091259 missense probably damaging 1.00
R4411:Usp2 UTSW 9 44091063 missense probably damaging 1.00
R4894:Usp2 UTSW 9 44075828 missense probably benign 0.03
R4960:Usp2 UTSW 9 44075813 missense probably damaging 1.00
R5496:Usp2 UTSW 9 44085208 missense possibly damaging 0.95
R5932:Usp2 UTSW 9 44092333 missense probably benign
R6956:Usp2 UTSW 9 44092756 missense probably damaging 1.00
R7007:Usp2 UTSW 9 44090042 missense probably damaging 1.00
R7224:Usp2 UTSW 9 44075969 missense possibly damaging 0.95
R7635:Usp2 UTSW 9 44067222 critical splice donor site probably null
R7707:Usp2 UTSW 9 44073460 intron probably null
RF007:Usp2 UTSW 9 44089121 critical splice acceptor site probably benign
RF012:Usp2 UTSW 9 44089130 critical splice acceptor site probably benign
RF015:Usp2 UTSW 9 44089109 critical splice acceptor site probably benign
RF036:Usp2 UTSW 9 44089124 critical splice acceptor site probably benign
RF046:Usp2 UTSW 9 44089111 critical splice acceptor site probably benign
RF051:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
RF053:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AAATAGGCATTCCTCCCTGC -3'
(R):5'- GGCAACTTCCTTTTAGCAGTGC -3'

Sequencing Primer
(F):5'- TGCTCTCCAAGACCCAGACAG -3'
(R):5'- AGCAGTGCTTCCTGCTG -3'
Posted On2016-10-06