Incidental Mutation 'R5482:Acy1'
ID434393
Institutional Source Beutler Lab
Gene Symbol Acy1
Ensembl Gene ENSMUSG00000023262
Gene Nameaminoacylase 1
Synonyms1110014J22Rik, Acy-1
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5482 (G1)
Quality Score145
Status Validated
Chromosome9
Chromosomal Location106432981-106438319 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 106434639 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024031] [ENSMUST00000059802] [ENSMUST00000098994] [ENSMUST00000150576] [ENSMUST00000190803] [ENSMUST00000190900] [ENSMUST00000190972] [ENSMUST00000213448] [ENSMUST00000214067] [ENSMUST00000216400] [ENSMUST00000215395] [ENSMUST00000215506] [ENSMUST00000214275] [ENSMUST00000217081]
Predicted Effect probably benign
Transcript: ENSMUST00000024031
SMART Domains Protein: ENSMUSP00000024031
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M28 61 239 8.6e-8 PFAM
Pfam:Peptidase_M20 76 397 1.8e-38 PFAM
Pfam:M20_dimer 188 302 1.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059802
SMART Domains Protein: ENSMUSP00000080203
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 1.4e-30 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098994
SMART Domains Protein: ENSMUSP00000096592
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 2.6e-27 PFAM
low complexity region 126 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150576
SMART Domains Protein: ENSMUSP00000117834
Gene: ENSMUSG00000048758

DomainStartEndE-ValueType
Pfam:Ribosomal_L29e 3 42 9.8e-28 PFAM
low complexity region 126 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189097
Predicted Effect probably benign
Transcript: ENSMUST00000190803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190851
Predicted Effect probably benign
Transcript: ENSMUST00000190900
SMART Domains Protein: ENSMUSP00000140582
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
PDB:1Q7L|C 1 50 9e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190972
SMART Domains Protein: ENSMUSP00000139953
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
Pfam:Peptidase_M20 76 216 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213448
Predicted Effect probably benign
Transcript: ENSMUST00000214067
Predicted Effect probably benign
Transcript: ENSMUST00000216400
Predicted Effect probably benign
Transcript: ENSMUST00000215395
Predicted Effect probably benign
Transcript: ENSMUST00000215506
Predicted Effect probably benign
Transcript: ENSMUST00000214275
Predicted Effect probably benign
Transcript: ENSMUST00000217531
Predicted Effect probably benign
Transcript: ENSMUST00000217081
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Acy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Acy1 APN 9 106436807 unclassified probably benign
IGL03029:Acy1 APN 9 106435115 missense probably damaging 0.98
IGL03304:Acy1 APN 9 106435466 critical splice donor site probably null
R0691:Acy1 UTSW 9 106435871 splice site probably null
R2152:Acy1 UTSW 9 106435617 missense probably damaging 1.00
R3882:Acy1 UTSW 9 106435509 missense possibly damaging 0.75
R4019:Acy1 UTSW 9 106436779 missense possibly damaging 0.94
R4421:Acy1 UTSW 9 106435713 splice site probably null
R4700:Acy1 UTSW 9 106433583 missense probably benign 0.00
R4931:Acy1 UTSW 9 106433191 missense probably damaging 1.00
R4934:Acy1 UTSW 9 106435122 missense probably null 1.00
R5030:Acy1 UTSW 9 106433397 missense probably benign 0.31
R5748:Acy1 UTSW 9 106436727 missense probably damaging 1.00
R6932:Acy1 UTSW 9 106437627 critical splice donor site probably null
R7468:Acy1 UTSW 9 106437722 start codon destroyed probably null 0.64
R7768:Acy1 UTSW 9 106433618 missense possibly damaging 0.90
R8144:Acy1 UTSW 9 106436120 splice site probably null
R8226:Acy1 UTSW 9 106437658 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCAGAGGTCCTACACAAGC -3'
(R):5'- CCAATACTGATGCAGGCTGC -3'

Sequencing Primer
(F):5'- GGTCCTACACAAGCCCAGACTTAG -3'
(R):5'- GAACCCTCACCTGAAGGAAGG -3'
Posted On2016-10-06