Incidental Mutation 'R5482:Dock3'
ID 434394
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Name dedicator of cyto-kinesis 3
Synonyms Moca, PBP
MMRRC Submission 043043-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.549) question?
Stock # R5482 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 106770024-107109108 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 106855937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 741 (R741*)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000044532
AA Change: R741*
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: R741*

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230109A22Rik T C 15: 25,139,036 (GRCm39) noncoding transcript Het
Abca15 T C 7: 119,968,370 (GRCm39) L801P probably damaging Het
Acap3 A G 4: 155,984,613 (GRCm39) D212G probably benign Het
Acsl6 G A 11: 54,217,964 (GRCm39) D166N probably damaging Het
Acy1 T C 9: 106,311,838 (GRCm39) probably benign Het
Adgrl3 A G 5: 81,942,360 (GRCm39) N1368S probably damaging Het
Akap5 T C 12: 76,375,600 (GRCm39) I344T probably benign Het
Aplp1 A G 7: 30,139,600 (GRCm39) F399S probably damaging Het
Arap3 A G 18: 38,107,727 (GRCm39) S1302P possibly damaging Het
Bik T G 15: 83,428,335 (GRCm39) V121G probably damaging Het
Birc6 A T 17: 74,948,777 (GRCm39) M3069L possibly damaging Het
Birc6 A G 17: 74,969,685 (GRCm39) T4237A probably damaging Het
Btn2a2 T C 13: 23,670,557 (GRCm39) N59D probably benign Het
Cabyr A G 18: 12,884,496 (GRCm39) S328G possibly damaging Het
Cfap57 C T 4: 118,426,838 (GRCm39) G1067R probably benign Het
Cryl1 A T 14: 57,550,469 (GRCm39) F132I probably damaging Het
Dipk1a C G 5: 108,057,529 (GRCm39) C343S probably damaging Het
Dnah8 G A 17: 31,019,521 (GRCm39) E3865K probably damaging Het
Fsip2 C T 2: 82,815,654 (GRCm39) L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 (GRCm39) Y39S probably benign Het
Gm5535 C A 2: 144,016,492 (GRCm39) noncoding transcript Het
Gmcl1 A T 6: 86,695,055 (GRCm39) M202K probably damaging Het
Hecw2 T A 1: 53,965,360 (GRCm39) M489L probably benign Het
Lrrk1 A G 7: 65,980,418 (GRCm39) I254T probably benign Het
Lrrn3 A C 12: 41,502,387 (GRCm39) C643W probably damaging Het
Lrrn3 G A 12: 41,502,386 (GRCm39) L644F probably benign Het
Nr2f6 A T 8: 71,827,182 (GRCm39) I373N probably damaging Het
Nt5dc3 A G 10: 86,647,395 (GRCm39) Y130C probably damaging Het
Or5b12 T C 19: 12,897,269 (GRCm39) T135A probably damaging Het
Or6c3 T C 10: 129,308,947 (GRCm39) Y129H probably benign Het
Otogl T A 10: 107,657,802 (GRCm39) I1043F probably damaging Het
Padi3 G A 4: 140,523,154 (GRCm39) T302I probably damaging Het
Pcdhgb5 A G 18: 37,864,585 (GRCm39) N127D probably damaging Het
Pign A G 1: 105,474,435 (GRCm39) F876L probably benign Het
Pip5k1c A G 10: 81,128,897 (GRCm39) E2G probably damaging Het
Ppp1r18 G A 17: 36,184,771 (GRCm39) E141K probably damaging Het
Ralbp1 A C 17: 66,168,563 (GRCm39) Y247* probably null Het
Ripply2 A G 9: 86,897,620 (GRCm39) E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,785,191 (GRCm39) probably null Het
Skint2 T G 4: 112,483,076 (GRCm39) C160W probably damaging Het
Sun2 C T 15: 79,621,712 (GRCm39) R172Q probably benign Het
Syna A G 5: 134,588,028 (GRCm39) L307P possibly damaging Het
Tlcd3b A G 7: 126,426,660 (GRCm39) T78A possibly damaging Het
Trappc12 T C 12: 28,741,324 (GRCm39) K795R probably damaging Het
Trmt9b A T 8: 36,979,203 (GRCm39) M269L probably benign Het
Ttll11 A G 2: 35,642,418 (GRCm39) S638P probably damaging Het
Usp2 G A 9: 44,000,480 (GRCm39) probably null Het
Vmn2r26 A T 6: 124,038,285 (GRCm39) E620V possibly damaging Het
Wdr36 A T 18: 32,974,957 (GRCm39) H103L probably benign Het
Wnt5b T C 6: 119,423,392 (GRCm39) T78A probably benign Het
Zc2hc1b C T 10: 13,029,270 (GRCm39) R146Q probably damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106,788,576 (GRCm39) splice site probably benign
IGL01067:Dock3 APN 9 106,959,572 (GRCm39) critical splice donor site probably null
IGL01160:Dock3 APN 9 106,783,887 (GRCm39) missense probably damaging 1.00
IGL01290:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01291:Dock3 APN 9 106,835,599 (GRCm39) splice site probably benign
IGL01391:Dock3 APN 9 106,784,433 (GRCm39) missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106,870,670 (GRCm39) missense probably benign 0.06
IGL01660:Dock3 APN 9 106,909,563 (GRCm39) splice site probably benign
IGL01752:Dock3 APN 9 106,902,512 (GRCm39) splice site probably benign
IGL01820:Dock3 APN 9 106,773,092 (GRCm39) missense probably damaging 1.00
IGL01908:Dock3 APN 9 106,783,861 (GRCm39) missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106,815,340 (GRCm39) missense probably benign
IGL02227:Dock3 APN 9 106,939,254 (GRCm39) missense probably damaging 0.98
IGL02309:Dock3 APN 9 106,790,351 (GRCm39) missense probably damaging 1.00
IGL02408:Dock3 APN 9 106,790,298 (GRCm39) splice site probably benign
IGL02469:Dock3 APN 9 106,863,215 (GRCm39) missense probably damaging 0.98
IGL02545:Dock3 APN 9 106,939,271 (GRCm39) missense probably damaging 1.00
IGL02894:Dock3 APN 9 106,807,298 (GRCm39) missense probably benign 0.00
IGL02934:Dock3 APN 9 106,900,944 (GRCm39) missense probably benign 0.01
IGL03027:Dock3 APN 9 106,870,677 (GRCm39) missense probably damaging 0.98
IGL03068:Dock3 APN 9 106,841,958 (GRCm39) missense possibly damaging 0.82
IGL03128:Dock3 APN 9 106,909,491 (GRCm39) missense probably benign 0.05
IGL03161:Dock3 APN 9 106,900,987 (GRCm39) missense probably damaging 0.99
IGL03263:Dock3 APN 9 106,807,330 (GRCm39) splice site probably benign
IGL03279:Dock3 APN 9 106,788,447 (GRCm39) splice site probably benign
IGL03366:Dock3 APN 9 106,882,632 (GRCm39) missense probably benign 0.01
Implosion UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
Squeeze UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
Tight UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106,772,862 (GRCm39) missense probably benign
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106,790,467 (GRCm39) missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106,789,512 (GRCm39) missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0076:Dock3 UTSW 9 106,788,685 (GRCm39) splice site probably benign
R0206:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0208:Dock3 UTSW 9 106,874,195 (GRCm39) nonsense probably null
R0384:Dock3 UTSW 9 106,779,094 (GRCm39) splice site probably benign
R0610:Dock3 UTSW 9 106,900,987 (GRCm39) missense probably damaging 0.99
R0731:Dock3 UTSW 9 106,847,055 (GRCm39) missense probably damaging 1.00
R1184:Dock3 UTSW 9 106,846,999 (GRCm39) missense probably damaging 1.00
R1350:Dock3 UTSW 9 106,791,831 (GRCm39) missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106,788,548 (GRCm39) missense probably damaging 1.00
R1424:Dock3 UTSW 9 106,790,392 (GRCm39) missense probably damaging 1.00
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1469:Dock3 UTSW 9 106,832,908 (GRCm39) missense probably benign 0.37
R1539:Dock3 UTSW 9 106,874,112 (GRCm39) missense probably benign 0.23
R1539:Dock3 UTSW 9 106,829,563 (GRCm39) missense probably damaging 1.00
R1571:Dock3 UTSW 9 106,815,158 (GRCm39) missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106,851,040 (GRCm39) missense probably damaging 0.98
R1795:Dock3 UTSW 9 106,902,534 (GRCm39) missense probably damaging 0.99
R1987:Dock3 UTSW 9 106,985,620 (GRCm39) missense probably benign 0.01
R2000:Dock3 UTSW 9 106,870,160 (GRCm39) splice site probably benign
R2074:Dock3 UTSW 9 106,870,662 (GRCm39) missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106,870,743 (GRCm39) missense probably benign 0.00
R2265:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2269:Dock3 UTSW 9 106,818,525 (GRCm39) missense probably damaging 1.00
R2370:Dock3 UTSW 9 106,829,554 (GRCm39) missense probably damaging 1.00
R2377:Dock3 UTSW 9 106,773,090 (GRCm39) missense probably damaging 0.98
R2385:Dock3 UTSW 9 106,868,324 (GRCm39) missense probably damaging 1.00
R2426:Dock3 UTSW 9 106,791,740 (GRCm39) missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106,818,725 (GRCm39) critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106,788,542 (GRCm39) missense probably damaging 0.99
R4052:Dock3 UTSW 9 106,850,995 (GRCm39) missense probably damaging 0.99
R4294:Dock3 UTSW 9 106,807,242 (GRCm39) missense probably damaging 1.00
R4623:Dock3 UTSW 9 106,939,244 (GRCm39) missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106,870,743 (GRCm39) missense possibly damaging 0.71
R4705:Dock3 UTSW 9 106,902,535 (GRCm39) missense probably damaging 1.00
R4771:Dock3 UTSW 9 106,829,557 (GRCm39) missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106,870,171 (GRCm39) missense possibly damaging 0.75
R4898:Dock3 UTSW 9 106,807,266 (GRCm39) missense probably damaging 1.00
R4948:Dock3 UTSW 9 106,868,354 (GRCm39) missense probably damaging 0.96
R4961:Dock3 UTSW 9 106,818,515 (GRCm39) missense probably damaging 1.00
R4986:Dock3 UTSW 9 106,809,182 (GRCm39) missense probably damaging 1.00
R5054:Dock3 UTSW 9 106,815,105 (GRCm39) missense probably damaging 1.00
R5065:Dock3 UTSW 9 106,832,883 (GRCm39) missense probably damaging 1.00
R5081:Dock3 UTSW 9 106,868,292 (GRCm39) missense probably damaging 1.00
R5101:Dock3 UTSW 9 106,846,980 (GRCm39) missense probably damaging 1.00
R5135:Dock3 UTSW 9 106,810,196 (GRCm39) missense probably damaging 1.00
R5227:Dock3 UTSW 9 106,863,269 (GRCm39) missense probably damaging 1.00
R5257:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5258:Dock3 UTSW 9 106,874,124 (GRCm39) missense probably damaging 1.00
R5273:Dock3 UTSW 9 106,777,904 (GRCm39) critical splice donor site probably null
R5322:Dock3 UTSW 9 106,779,028 (GRCm39) missense probably benign 0.14
R5553:Dock3 UTSW 9 106,868,309 (GRCm39) missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106,832,898 (GRCm39) missense probably benign 0.01
R5739:Dock3 UTSW 9 106,850,995 (GRCm39) missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106,772,687 (GRCm39) missense possibly damaging 0.51
R5888:Dock3 UTSW 9 106,901,002 (GRCm39) missense probably benign 0.12
R5960:Dock3 UTSW 9 106,788,554 (GRCm39) nonsense probably null
R5974:Dock3 UTSW 9 106,871,261 (GRCm39) missense probably damaging 1.00
R6116:Dock3 UTSW 9 106,809,161 (GRCm39) missense probably damaging 1.00
R6162:Dock3 UTSW 9 106,841,998 (GRCm39) missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6219:Dock3 UTSW 9 106,872,080 (GRCm39) missense probably damaging 1.00
R6238:Dock3 UTSW 9 106,790,147 (GRCm39) missense probably benign 0.05
R6266:Dock3 UTSW 9 106,841,952 (GRCm39) missense probably damaging 0.99
R6291:Dock3 UTSW 9 106,785,631 (GRCm39) missense probably benign
R6531:Dock3 UTSW 9 106,844,415 (GRCm39) missense probably benign
R6567:Dock3 UTSW 9 106,773,946 (GRCm39) missense probably benign 0.13
R6572:Dock3 UTSW 9 106,866,674 (GRCm39) missense probably damaging 0.99
R6620:Dock3 UTSW 9 106,815,125 (GRCm39) missense probably benign 0.00
R6726:Dock3 UTSW 9 107,036,651 (GRCm39) nonsense probably null
R7085:Dock3 UTSW 9 106,779,086 (GRCm39) missense probably damaging 1.00
R7151:Dock3 UTSW 9 106,841,916 (GRCm39) missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106,772,723 (GRCm39) missense probably benign 0.20
R7357:Dock3 UTSW 9 106,882,568 (GRCm39) missense probably benign 0.34
R7423:Dock3 UTSW 9 106,844,370 (GRCm39) missense probably damaging 0.98
R7426:Dock3 UTSW 9 106,772,782 (GRCm39) missense probably benign
R7439:Dock3 UTSW 9 106,900,931 (GRCm39) missense probably damaging 1.00
R7452:Dock3 UTSW 9 106,866,664 (GRCm39) missense probably damaging 1.00
R7470:Dock3 UTSW 9 106,882,644 (GRCm39) missense probably damaging 1.00
R7879:Dock3 UTSW 9 106,785,700 (GRCm39) missense probably benign 0.05
R8047:Dock3 UTSW 9 106,870,208 (GRCm39) missense possibly damaging 0.93
R8308:Dock3 UTSW 9 106,790,371 (GRCm39) missense probably benign 0.00
R8837:Dock3 UTSW 9 106,774,539 (GRCm39) missense probably benign
R8862:Dock3 UTSW 9 106,855,927 (GRCm39) missense probably damaging 1.00
R8952:Dock3 UTSW 9 106,850,958 (GRCm39) missense probably benign 0.03
R9230:Dock3 UTSW 9 106,807,223 (GRCm39) missense probably damaging 1.00
R9269:Dock3 UTSW 9 106,818,522 (GRCm39) missense probably benign 0.01
R9272:Dock3 UTSW 9 106,774,569 (GRCm39) missense probably benign 0.00
R9344:Dock3 UTSW 9 106,870,763 (GRCm39) missense probably damaging 1.00
R9757:Dock3 UTSW 9 106,901,035 (GRCm39) missense possibly damaging 0.48
R9764:Dock3 UTSW 9 106,959,713 (GRCm39) missense probably benign 0.00
R9766:Dock3 UTSW 9 106,788,483 (GRCm39) missense probably benign 0.01
X0023:Dock3 UTSW 9 106,863,197 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCACCAGGCAGTGATAGAC -3'
(R):5'- AGTTGGAATCACCTGTCACCTG -3'

Sequencing Primer
(F):5'- CAGGCAGTGATAGACAGTTCCAATTC -3'
(R):5'- GGAATCACCTGTCACCTGATTTTG -3'
Posted On 2016-10-06