Incidental Mutation 'R5482:Olfr788'
ID434397
Institutional Source Beutler Lab
Gene Symbol Olfr788
Ensembl Gene ENSMUSG00000049217
Gene Nameolfactory receptor 788
SynonymsMOR111-4, GA_x6K02T2PULF-11151514-11152449
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129470998-129476618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129473078 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 129 (Y129H)
Ref Sequence ENSEMBL: ENSMUSP00000151054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056961] [ENSMUST00000213222]
Predicted Effect probably benign
Transcript: ENSMUST00000056961
AA Change: Y129H

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000054710
Gene: ENSMUSG00000049217
AA Change: Y129H

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-49 PFAM
Pfam:7tm_1 38 287 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213222
AA Change: Y129H

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.3085 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Olfr788
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr788 APN 10 129473211 missense probably damaging 1.00
IGL02393:Olfr788 APN 10 129473195 missense probably damaging 1.00
IGL03010:Olfr788 APN 10 129472974 missense probably damaging 1.00
IGL03325:Olfr788 APN 10 129473605 missense probably benign 0.02
R1298:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
R2215:Olfr788 UTSW 10 129473420 missense probably damaging 0.99
R5699:Olfr788 UTSW 10 129472877 missense probably damaging 1.00
R5794:Olfr788 UTSW 10 129473426 missense possibly damaging 0.95
R6436:Olfr788 UTSW 10 129472904 missense probably damaging 0.98
R6480:Olfr788 UTSW 10 129472721 missense possibly damaging 0.62
R6884:Olfr788 UTSW 10 129473154 missense probably damaging 1.00
R7908:Olfr788 UTSW 10 129472998 missense probably damaging 1.00
R7989:Olfr788 UTSW 10 129472998 missense probably damaging 1.00
R8056:Olfr788 UTSW 10 129473192 missense probably benign 0.07
R8207:Olfr788 UTSW 10 129473084 missense probably benign 0.09
Z1176:Olfr788 UTSW 10 129473615 missense probably benign 0.04
Z1177:Olfr788 UTSW 10 129473064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACCAATGTATTTCTTCCTCCG -3'
(R):5'- ACAATGTATCTGAGCAAGACAGTTG -3'

Sequencing Primer
(F):5'- GTCTCATTTACAAGTGTATGTATCCC -3'
(R):5'- CAAGACAGTTGCAAGAGGGG -3'
Posted On2016-10-06