Incidental Mutation 'R5482:Lrrn3'
ID434400
Institutional Source Beutler Lab
Gene Symbol Lrrn3
Ensembl Gene ENSMUSG00000036295
Gene Nameleucine rich repeat protein 3, neuronal
SynonymsNLRR-3
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location41451668-41486431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41452387 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 644 (L644F)
Ref Sequence ENSEMBL: ENSMUSP00000043818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043884] [ENSMUST00000132121] [ENSMUST00000134965]
Predicted Effect probably benign
Transcript: ENSMUST00000043884
AA Change: L644F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043818
Gene: ENSMUSG00000036295
AA Change: L644F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 28 73 9.17e-4 SMART
LRR 115 138 2.63e0 SMART
LRR_TYP 139 162 1.5e-4 SMART
LRR 163 186 7.55e-1 SMART
LRR 187 210 1.76e1 SMART
LRR 211 234 1.62e1 SMART
LRR 235 258 5.11e0 SMART
LRR 260 282 3.18e1 SMART
LRR 333 356 4.44e0 SMART
LRRCT 368 420 3.7e-5 SMART
IGc2 435 503 5.04e-9 SMART
FN3 521 602 3.49e0 SMART
transmembrane domain 626 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132121
SMART Domains Protein: ENSMUSP00000118779
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 115 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134965
SMART Domains Protein: ENSMUSP00000116441
Gene: ENSMUSG00000056899

DomainStartEndE-ValueType
Pfam:Peptidase_S24 38 114 6.4e-11 PFAM
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Homozygous null mutant mice exhibited increased mean percent body fat and male homozygous mutant mice exhibited enhanced glucose tolerance when compared with controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Lrrn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Lrrn3 APN 12 41452192 intron probably benign
IGL02825:Lrrn3 APN 12 41452593 missense probably damaging 1.00
IGL02927:Lrrn3 APN 12 41453344 missense probably damaging 1.00
IGL02970:Lrrn3 APN 12 41452360 missense probably benign
IGL02995:Lrrn3 APN 12 41452217 missense probably damaging 1.00
IGL02999:Lrrn3 APN 12 41452751 missense probably benign 0.01
IGL03182:Lrrn3 APN 12 41454021 missense probably damaging 1.00
IGL03280:Lrrn3 APN 12 41454147 missense probably damaging 0.97
PIT4469001:Lrrn3 UTSW 12 41453018 missense probably benign 0.03
R0167:Lrrn3 UTSW 12 41454015 missense probably damaging 1.00
R0414:Lrrn3 UTSW 12 41453940 missense probably damaging 1.00
R0787:Lrrn3 UTSW 12 41454231 missense probably damaging 1.00
R0894:Lrrn3 UTSW 12 41454034 missense probably damaging 1.00
R1433:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R1610:Lrrn3 UTSW 12 41452993 missense possibly damaging 0.89
R1834:Lrrn3 UTSW 12 41453518 missense probably damaging 1.00
R2068:Lrrn3 UTSW 12 41452996 missense probably damaging 1.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R2871:Lrrn3 UTSW 12 41452723 missense probably benign 0.00
R3771:Lrrn3 UTSW 12 41452870 missense probably damaging 1.00
R4408:Lrrn3 UTSW 12 41454042 missense probably benign 0.04
R4410:Lrrn3 UTSW 12 41452584 missense possibly damaging 0.74
R4684:Lrrn3 UTSW 12 41454244 missense possibly damaging 0.75
R4770:Lrrn3 UTSW 12 41452443 missense probably benign 0.08
R4927:Lrrn3 UTSW 12 41453125 missense probably damaging 1.00
R5037:Lrrn3 UTSW 12 41453595 missense probably damaging 1.00
R5482:Lrrn3 UTSW 12 41452388 missense probably damaging 0.96
R5667:Lrrn3 UTSW 12 41452298 missense possibly damaging 0.77
R6022:Lrrn3 UTSW 12 41453430 missense probably damaging 0.96
R6087:Lrrn3 UTSW 12 41453535 missense possibly damaging 0.84
R6129:Lrrn3 UTSW 12 41453788 nonsense probably null
R6309:Lrrn3 UTSW 12 41453206 missense probably damaging 1.00
R7449:Lrrn3 UTSW 12 41453488 missense probably damaging 1.00
R7555:Lrrn3 UTSW 12 41452911 missense probably benign 0.01
R7560:Lrrn3 UTSW 12 41452713 missense possibly damaging 0.93
R8059:Lrrn3 UTSW 12 41454217 missense probably benign 0.22
R8134:Lrrn3 UTSW 12 41453048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCGGCACTCCTATAGC -3'
(R):5'- GCCCAAAGTGCTCGAATACC -3'

Sequencing Primer
(F):5'- GGCACTCCTATAGCCGTTG -3'
(R):5'- GCTCGAATACCATTTGATGTCAAGG -3'
Posted On2016-10-06