Incidental Mutation 'R5482:Sun2'
ID434406
Institutional Source Beutler Lab
Gene Symbol Sun2
Ensembl Gene ENSMUSG00000042524
Gene NameSad1 and UNC84 domain containing 2
SynonymsUnc84b, B230369L08Rik
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79724070-79742536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79737511 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 172 (R172Q)
Ref Sequence ENSEMBL: ENSMUSP00000098006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046259] [ENSMUST00000089311] [ENSMUST00000100439] [ENSMUST00000159660] [ENSMUST00000160355] [ENSMUST00000162499]
Predicted Effect probably benign
Transcript: ENSMUST00000046259
AA Change: R172Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047864
Gene: ENSMUSG00000042524
AA Change: R172Q

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
coiled coil region 418 453 N/A INTRINSIC
coiled coil region 491 519 N/A INTRINSIC
Pfam:Sad1_UNC 595 729 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089311
SMART Domains Protein: ENSMUSP00000086724
Gene: ENSMUSG00000042524

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
coiled coil region 386 421 N/A INTRINSIC
coiled coil region 459 487 N/A INTRINSIC
Pfam:Sad1_UNC 563 697 1.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100439
AA Change: R172Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000098006
Gene: ENSMUSG00000042524
AA Change: R172Q

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 416 451 N/A INTRINSIC
coiled coil region 489 517 N/A INTRINSIC
Pfam:Sad1_UNC 593 727 1.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159660
SMART Domains Protein: ENSMUSP00000124504
Gene: ENSMUSG00000042524

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159762
Predicted Effect probably benign
Transcript: ENSMUST00000160355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162392
Predicted Effect probably benign
Transcript: ENSMUST00000162499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231189
Meta Mutation Damage Score 0.4143 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUN1 (MIM 607723) and SUN2 are inner nuclear membrane (INM) proteins that play a major role in nuclear-cytoplasmic connection by formation of a 'bridge' across the nuclear envelope, known as the LINC complex, via interaction with the conserved luminal KASH domain of nesprins (e.g., SYNE1; MIM 608441) located in the outer nuclear membrane (ONM). The LINC complex provides a direct connection between the nuclear lamina and the cytoskeleton, which contributes to nuclear positioning and cellular rigidity (summary by Haque et al., 2010 [PubMed 19933576]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Sun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03325:Sun2 APN 15 79738648 missense probably benign 0.34
R0049:Sun2 UTSW 15 79727609 splice site probably benign
R0049:Sun2 UTSW 15 79727609 splice site probably benign
R0189:Sun2 UTSW 15 79737076 missense probably damaging 1.00
R0349:Sun2 UTSW 15 79730232 missense probably damaging 1.00
R1183:Sun2 UTSW 15 79728468 missense probably damaging 1.00
R1751:Sun2 UTSW 15 79725557 missense probably benign
R1767:Sun2 UTSW 15 79725557 missense probably benign
R1843:Sun2 UTSW 15 79737563 missense probably benign
R2005:Sun2 UTSW 15 79726624 missense possibly damaging 0.80
R2062:Sun2 UTSW 15 79738651 missense probably damaging 1.00
R2358:Sun2 UTSW 15 79727913 missense possibly damaging 0.95
R3712:Sun2 UTSW 15 79727913 missense possibly damaging 0.95
R3937:Sun2 UTSW 15 79734155 missense probably benign 0.14
R3938:Sun2 UTSW 15 79734155 missense probably benign 0.14
R4869:Sun2 UTSW 15 79728386 intron probably benign
R4871:Sun2 UTSW 15 79727564 missense probably damaging 1.00
R5375:Sun2 UTSW 15 79727522 missense probably damaging 1.00
R5555:Sun2 UTSW 15 79734127 missense probably benign 0.01
R5657:Sun2 UTSW 15 79727949 nonsense probably null
R5662:Sun2 UTSW 15 79738868 missense probably benign 0.01
R6144:Sun2 UTSW 15 79730332 missense probably benign
R6975:Sun2 UTSW 15 79734219 nonsense probably null
R7127:Sun2 UTSW 15 79727899 missense probably benign 0.00
R7358:Sun2 UTSW 15 79734112 missense probably benign 0.29
R7614:Sun2 UTSW 15 79739024 splice site probably null
R8181:Sun2 UTSW 15 79725520 missense probably damaging 0.99
R8343:Sun2 UTSW 15 79738924 missense probably damaging 1.00
Z1177:Sun2 UTSW 15 79738520 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTGCTCAAACCTGCTAG -3'
(R):5'- TCACTTCACAAACATTCCTGGATC -3'

Sequencing Primer
(F):5'- TCAAACCTGCTAGGGGGTTC -3'
(R):5'- CACAAACATTCCTGGATCTACTGTG -3'
Posted On2016-10-06