Incidental Mutation 'R5482:Cabyr'
ID434412
Institutional Source Beutler Lab
Gene Symbol Cabyr
Ensembl Gene ENSMUSG00000024430
Gene Namecalcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2)
SynonymsFSP-2, 4933421A18Rik, CBP86, 1700016C01Rik
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12741324-12755146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12751439 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 328 (S328G)
Ref Sequence ENSEMBL: ENSMUSP00000140894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000191078] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000121888]
Predicted Effect probably benign
Transcript: ENSMUST00000074352
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080415
AA Change: S328G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430
AA Change: S328G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115857
AA Change: S328G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430
AA Change: S328G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119512
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121018
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121774
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191078
AA Change: S328G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430
AA Change: S328G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150758
AA Change: S328G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430
AA Change: S328G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186263
AA Change: S328G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430
AA Change: S328G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121888
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout affects sperm flagellum morphology, resulting in reduced sperm motility. These mutant males are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wdr36 A T 18: 32,841,904 H103L probably benign Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Cabyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Cabyr APN 18 12744610 missense probably damaging 0.99
R0547:Cabyr UTSW 18 12751016 missense probably benign 0.07
R0571:Cabyr UTSW 18 12750852 missense probably damaging 1.00
R1556:Cabyr UTSW 18 12744780 missense probably damaging 1.00
R3084:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3085:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3086:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3824:Cabyr UTSW 18 12751690 missense probably benign 0.04
R3898:Cabyr UTSW 18 12751523 missense probably benign 0.00
R4869:Cabyr UTSW 18 12751818 makesense probably null
R4933:Cabyr UTSW 18 12744492 splice site probably benign
R5036:Cabyr UTSW 18 12751246 missense probably damaging 1.00
R5932:Cabyr UTSW 18 12754350 missense probably damaging 1.00
R6515:Cabyr UTSW 18 12754283 missense possibly damaging 0.93
R6556:Cabyr UTSW 18 12751016 missense probably benign 0.07
R6852:Cabyr UTSW 18 12754097 missense probably benign 0.35
R6907:Cabyr UTSW 18 12750912 missense probably benign 0.05
R7193:Cabyr UTSW 18 12751758 missense probably damaging 1.00
R7565:Cabyr UTSW 18 12744599 missense possibly damaging 0.50
R7777:Cabyr UTSW 18 12744771 missense probably damaging 1.00
R7941:Cabyr UTSW 18 12744768 missense probably damaging 1.00
R8243:Cabyr UTSW 18 12750702 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCATGAAGCTCCTGATACCC -3'
(R):5'- CGATCTCCGTTTCAAGGTGC -3'

Sequencing Primer
(F):5'- CAGGTTACATCAGCCAGTCGTATATC -3'
(R):5'- GAGGCTACTTTGAAAAAGCCCTCTG -3'
Posted On2016-10-06