Incidental Mutation 'R5482:Wdr36'
ID434413
Institutional Source Beutler Lab
Gene Symbol Wdr36
Ensembl Gene ENSMUSG00000038299
Gene NameWD repeat domain 36
Synonyms5730444A13Rik
MMRRC Submission 043043-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5482 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location32837225-32866420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32841904 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 103 (H103L)
Ref Sequence ENSEMBL: ENSMUSP00000132189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053663] [ENSMUST00000166214]
Predicted Effect probably benign
Transcript: ENSMUST00000053663
AA Change: H103L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052465
Gene: ENSMUSG00000038299
AA Change: H103L

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 673 895 9.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166214
AA Change: H103L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132189
Gene: ENSMUSG00000038299
AA Change: H103L

DomainStartEndE-ValueType
WD40 98 135 3.21e-1 SMART
Blast:WD40 140 180 3e-15 BLAST
WD40 183 222 9.21e0 SMART
WD40 226 265 1.43e0 SMART
WD40 268 308 5.35e-1 SMART
WD40 315 355 7.43e-1 SMART
WD40 473 515 1.46e-1 SMART
WD40 559 598 2.2e-10 SMART
WD40 601 640 1.43e1 SMART
Pfam:Utp21 668 883 6.1e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181632
Meta Mutation Damage Score 0.8589 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.6%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Mutations in this gene have been associated with adult-onset primary open-angle glaucoma (POAG). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality before implantation. In culture, homozygous mutant embryos fail to reach the blastocyst stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,512,049 M269L probably benign Het
9230109A22Rik T C 15: 25,138,950 noncoding transcript Het
Abca15 T C 7: 120,369,147 L801P probably damaging Het
Acap3 A G 4: 155,900,156 D212G probably benign Het
Acsl6 G A 11: 54,327,138 D166N probably damaging Het
Acy1 T C 9: 106,434,639 probably benign Het
Adgrl3 A G 5: 81,794,513 N1368S probably damaging Het
Akap5 T C 12: 76,328,826 I344T probably benign Het
Aplp1 A G 7: 30,440,175 F399S probably damaging Het
Arap3 A G 18: 37,974,674 S1302P possibly damaging Het
Bik T G 15: 83,544,134 V121G probably damaging Het
Birc6 A T 17: 74,641,782 M3069L possibly damaging Het
Birc6 A G 17: 74,662,690 T4237A probably damaging Het
Btn2a2 T C 13: 23,486,387 N59D probably benign Het
Cabyr A G 18: 12,751,439 S328G possibly damaging Het
Cfap57 C T 4: 118,569,641 G1067R probably benign Het
Cryl1 A T 14: 57,313,012 F132I probably damaging Het
Dnah8 G A 17: 30,800,547 E3865K probably damaging Het
Dock3 G A 9: 106,978,738 R741* probably null Het
Fam57b A G 7: 126,827,488 T78A possibly damaging Het
Fam69a C G 5: 107,909,663 C343S probably damaging Het
Fsip2 C T 2: 82,985,310 L3796F possibly damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5535 C A 2: 144,174,572 noncoding transcript Het
Gmcl1 A T 6: 86,718,073 M202K probably damaging Het
Hecw2 T A 1: 53,926,201 M489L probably benign Het
Lrrk1 A G 7: 66,330,670 I254T probably benign Het
Lrrn3 G A 12: 41,452,387 L644F probably benign Het
Lrrn3 A C 12: 41,452,388 C643W probably damaging Het
Nr2f6 A T 8: 71,374,538 I373N probably damaging Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1448 T C 19: 12,919,905 T135A probably damaging Het
Olfr788 T C 10: 129,473,078 Y129H probably benign Het
Otogl T A 10: 107,821,941 I1043F probably damaging Het
Padi3 G A 4: 140,795,843 T302I probably damaging Het
Pcdhgb5 A G 18: 37,731,532 N127D probably damaging Het
Pign A G 1: 105,546,710 F876L probably benign Het
Pip5k1c A G 10: 81,293,063 E2G probably damaging Het
Ppp1r18 G A 17: 35,873,879 E141K probably damaging Het
Ralbp1 A C 17: 65,861,568 Y247* probably null Het
Ripply2 A G 9: 87,015,567 E8G possibly damaging Het
Rufy3 TAAGCA TA 5: 88,637,332 probably null Het
Skint2 T G 4: 112,625,879 C160W probably damaging Het
Sun2 C T 15: 79,737,511 R172Q probably benign Het
Syna A G 5: 134,559,174 L307P possibly damaging Het
Trappc12 T C 12: 28,691,325 K795R probably damaging Het
Ttll11 A G 2: 35,752,406 S638P probably damaging Het
Usp2 G A 9: 44,089,183 probably null Het
Vmn2r26 A T 6: 124,061,326 E620V possibly damaging Het
Wnt5b T C 6: 119,446,431 T78A probably benign Het
Zc2hc1b C T 10: 13,153,526 R146Q probably damaging Het
Other mutations in Wdr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Wdr36 APN 18 32845631 missense possibly damaging 0.86
IGL01975:Wdr36 APN 18 32852488 missense probably damaging 1.00
IGL02001:Wdr36 APN 18 32852888 missense probably damaging 1.00
IGL02605:Wdr36 APN 18 32851991 missense possibly damaging 0.94
IGL02625:Wdr36 APN 18 32859261 missense possibly damaging 0.51
IGL02928:Wdr36 APN 18 32847319 critical splice donor site probably null
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0025:Wdr36 UTSW 18 32859307 missense probably damaging 1.00
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0062:Wdr36 UTSW 18 32864749 missense possibly damaging 0.90
R0331:Wdr36 UTSW 18 32852915 missense possibly damaging 0.83
R0626:Wdr36 UTSW 18 32850531 missense probably damaging 1.00
R0835:Wdr36 UTSW 18 32849082 missense possibly damaging 0.87
R1484:Wdr36 UTSW 18 32843885 missense possibly damaging 0.77
R1498:Wdr36 UTSW 18 32852968 missense possibly damaging 0.95
R3522:Wdr36 UTSW 18 32861485 splice site probably null
R4521:Wdr36 UTSW 18 32841148 splice site probably null
R4902:Wdr36 UTSW 18 32859261 missense possibly damaging 0.51
R5574:Wdr36 UTSW 18 32865959 missense probably damaging 1.00
R5627:Wdr36 UTSW 18 32861638 missense possibly damaging 0.73
R6076:Wdr36 UTSW 18 32846945 missense probably damaging 1.00
R6186:Wdr36 UTSW 18 32852901 missense probably benign 0.19
R6228:Wdr36 UTSW 18 32842006 missense possibly damaging 0.67
R7027:Wdr36 UTSW 18 32841905 missense probably benign 0.04
R7112:Wdr36 UTSW 18 32839451 missense probably benign 0.34
R7635:Wdr36 UTSW 18 32850525 missense probably benign 0.19
R7642:Wdr36 UTSW 18 32854571 splice site probably null
R7998:Wdr36 UTSW 18 32852519 missense probably damaging 1.00
R8200:Wdr36 UTSW 18 32865926 missense probably benign 0.10
R8203:Wdr36 UTSW 18 32852083 nonsense probably null
R8334:Wdr36 UTSW 18 32859293 missense possibly damaging 0.95
X0063:Wdr36 UTSW 18 32864722 missense probably damaging 0.96
Z1088:Wdr36 UTSW 18 32866012 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCCTGGTTCCTTATTATG -3'
(R):5'- ACATGCTAGACAGTCTCAGTG -3'

Sequencing Primer
(F):5'- GTCATCATTTTAGTCTCAGGCAAGAG -3'
(R):5'- GTGTACATGTGAAAACTCTCGTAG -3'
Posted On2016-10-06