Incidental Mutation 'R5483:Serpinb3a'
ID434420
Institutional Source Beutler Lab
Gene Symbol Serpinb3a
Ensembl Gene ENSMUSG00000044594
Gene Nameserine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A
SynonymsSqn5
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location107045587-107052303 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107047169 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 211 (K211N)
Ref Sequence ENSEMBL: ENSMUSP00000108337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]
Predicted Effect probably benign
Transcript: ENSMUST00000027567
AA Change: K211N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594
AA Change: K211N

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112717
AA Change: K211N

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594
AA Change: K211N

DomainStartEndE-ValueType
SERPIN 13 387 6.36e-182 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Serpinb3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Serpinb3a APN 1 107051059 nonsense probably null
IGL01940:Serpinb3a APN 1 107046185 missense probably damaging 1.00
IGL02077:Serpinb3a APN 1 107046381 missense probably damaging 0.99
IGL02136:Serpinb3a APN 1 107046285 missense probably benign 0.15
IGL02214:Serpinb3a APN 1 107048488 critical splice donor site probably null
IGL02239:Serpinb3a APN 1 107051688 missense probably benign 0.05
IGL02508:Serpinb3a APN 1 107046072 missense probably damaging 1.00
IGL02533:Serpinb3a APN 1 107047162 missense probably benign 0.00
IGL02860:Serpinb3a APN 1 107049453 splice site probably benign
IGL03013:Serpinb3a APN 1 107046083 missense probably damaging 1.00
IGL03391:Serpinb3a APN 1 107046342 missense possibly damaging 0.81
R0321:Serpinb3a UTSW 1 107047482 nonsense probably null
R0416:Serpinb3a UTSW 1 107049386 missense probably benign 0.29
R0494:Serpinb3a UTSW 1 107047482 nonsense probably null
R0498:Serpinb3a UTSW 1 107047150 missense probably damaging 1.00
R1223:Serpinb3a UTSW 1 107047552 missense probably damaging 1.00
R1596:Serpinb3a UTSW 1 107047174 missense probably benign 0.12
R1655:Serpinb3a UTSW 1 107046212 missense probably damaging 1.00
R2156:Serpinb3a UTSW 1 107047472 critical splice donor site probably null
R2296:Serpinb3a UTSW 1 107047561 missense probably damaging 1.00
R4327:Serpinb3a UTSW 1 107051770 start codon destroyed probably damaging 1.00
R4612:Serpinb3a UTSW 1 107047607 missense probably damaging 0.99
R4830:Serpinb3a UTSW 1 107048586 missense probably benign 0.00
R5016:Serpinb3a UTSW 1 107046330 missense probably damaging 1.00
R5619:Serpinb3a UTSW 1 107047108 missense probably damaging 1.00
R7227:Serpinb3a UTSW 1 107051629 missense probably damaging 1.00
R8277:Serpinb3a UTSW 1 107046240 missense probably damaging 1.00
R8526:Serpinb3a UTSW 1 107048774 splice site probably null
Z1177:Serpinb3a UTSW 1 107051008 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGGTGAGACACAATATCTCCC -3'
(R):5'- ACCACAGAAGAAAAGTTTTGGC -3'

Sequencing Primer
(F):5'- GTGAGACACAATATCTCCCTTTAAAC -3'
(R):5'- CCACAGAAGAAAAGTTTTGGCTGAAC -3'
Posted On2016-10-06