Incidental Mutation 'R5483:Olfr1038-ps'
ID434423
Institutional Source Beutler Lab
Gene Symbol Olfr1038-ps
Ensembl Gene ENSMUSG00000050577
Gene Nameolfactory receptor 1038, pseudogene
SynonymsGA_x6K02T2Q125-47591072-47592031, MOR185-3
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86121925-86122879 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 86122618 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 232 (Q232*)
Ref Sequence ENSEMBL: ENSMUSP00000149609 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000149775
AA Change: Q232*
Predicted Effect probably null
Transcript: ENSMUST00000216665
AA Change: Q232*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Olfr1038-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Olfr1038-ps UTSW 2 86122760 frame shift probably null
R4276:Olfr1038-ps UTSW 2 86122279 missense probably damaging 1.00
R6464:Olfr1038-ps UTSW 2 86122408 missense possibly damaging 0.62
R6973:Olfr1038-ps UTSW 2 86122854 missense probably benign
R7508:Olfr1038-ps UTSW 2 86121938 missense possibly damaging 0.72
R7576:Olfr1038-ps UTSW 2 86122376 missense probably damaging 1.00
R7727:Olfr1038-ps UTSW 2 86122496 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCGCTTGACATATTGTGGACC -3'
(R):5'- AGAGGCATCTTTCACCTCTTTG -3'

Sequencing Primer
(F):5'- CGCTTGACATATTGTGGACCTAATG -3'
(R):5'- CCTAAGACTGTAGATGAGGGGGTTC -3'
Posted On2016-10-06