Incidental Mutation 'R5483:Vps39'
ID434424
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene NameVPS39 HOPS complex subunit
SynonymsmVam6, Vam6P, Vam6, A230065P22Rik
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120316461-120353137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120323083 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 670 (I670N)
Ref Sequence ENSEMBL: ENSMUSP00000099559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
Predicted Effect probably benign
Transcript: ENSMUST00000028752
AA Change: I659N

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: I659N

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102501
AA Change: I670N

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: I670N

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147085
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120350238 splice site probably benign
IGL01629:Vps39 APN 2 120323598 missense probably benign 0.11
IGL01812:Vps39 APN 2 120320790 splice site probably benign
IGL01936:Vps39 APN 2 120323128 missense probably benign 0.23
IGL02379:Vps39 APN 2 120323608 missense probably benign 0.17
IGL02892:Vps39 APN 2 120323171 splice site probably benign
IGL02943:Vps39 APN 2 120339487 missense possibly damaging 0.77
R0001:Vps39 UTSW 2 120318053 missense probably benign 0.09
R0329:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0364:Vps39 UTSW 2 120345638 missense probably damaging 1.00
R1483:Vps39 UTSW 2 120323648 missense probably damaging 1.00
R1625:Vps39 UTSW 2 120323625 missense probably damaging 1.00
R1837:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1839:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1934:Vps39 UTSW 2 120318077 missense probably damaging 1.00
R2018:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2019:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2178:Vps39 UTSW 2 120323679 nonsense probably null
R2513:Vps39 UTSW 2 120338787 missense probably damaging 1.00
R3771:Vps39 UTSW 2 120342016 missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120350175 missense probably benign 0.15
R4580:Vps39 UTSW 2 120339333 missense probably benign 0.35
R4815:Vps39 UTSW 2 120338559 missense probably benign 0.37
R4851:Vps39 UTSW 2 120321831 intron probably benign
R4894:Vps39 UTSW 2 120352959 missense probably damaging 1.00
R5447:Vps39 UTSW 2 120352932 missense probably benign 0.43
R5715:Vps39 UTSW 2 120325236 missense possibly damaging 0.73
R5886:Vps39 UTSW 2 120321572 intron probably benign
R5949:Vps39 UTSW 2 120328668 missense probably benign 0.23
R5954:Vps39 UTSW 2 120324662 missense probably damaging 1.00
R5973:Vps39 UTSW 2 120328705 missense probably damaging 0.99
R6004:Vps39 UTSW 2 120345650 missense possibly damaging 0.89
R6208:Vps39 UTSW 2 120333416 missense probably damaging 0.98
R6705:Vps39 UTSW 2 120320676 missense probably benign 0.00
R6915:Vps39 UTSW 2 120321031 nonsense probably null
R7535:Vps39 UTSW 2 120324695 missense probably damaging 1.00
R7780:Vps39 UTSW 2 120325199 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTCAGCCTCAGCAAAAGAG -3'
(R):5'- AAGCCCTTCCTTGATAACAGGG -3'

Sequencing Primer
(F):5'- CTCAGCAAAAGAGGGATGTGG -3'
(R):5'- CCTTGATAACAGGGTGACATCTCTG -3'
Posted On2016-10-06