Incidental Mutation 'R5483:Emc1'
ID434428
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139375376 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 949 (T949A)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: T946A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: T946A

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: T949A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: T949A

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: T949A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: T949A

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181556
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCCTGGAGTCCACTTGTTTG -3'
(R):5'- TCAGGGATCCAACAGTCCAC -3'

Sequencing Primer
(F):5'- TTTGGTGAGTGGCCCCAC -3'
(R):5'- AGTCCACGGCCATCTCCTTAG -3'
Posted On2016-10-06