Incidental Mutation 'R5483:Fbxo24'
ID434431
Institutional Source Beutler Lab
Gene Symbol Fbxo24
Ensembl Gene ENSMUSG00000089984
Gene NameF-box protein 24
Synonyms4933422D21Rik, Fbx24
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137612503-137629002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137618740 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 362 (A362T)
Ref Sequence ENSEMBL: ENSMUSP00000031732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031732] [ENSMUST00000111002] [ENSMUST00000124693] [ENSMUST00000136028] [ENSMUST00000155251]
Predicted Effect probably damaging
Transcript: ENSMUST00000031732
AA Change: A362T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031732
Gene: ENSMUSG00000089984
AA Change: A362T

DomainStartEndE-ValueType
FBOX 29 69 1.48e-7 SMART
Pfam:RCC1 386 432 2.2e-10 PFAM
low complexity region 442 455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111002
AA Change: A223T

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106630
Gene: ENSMUSG00000089984
AA Change: A223T

DomainStartEndE-ValueType
Pfam:RCC1 247 293 4.2e-11 PFAM
low complexity region 303 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117679
Predicted Effect probably benign
Transcript: ENSMUST00000124693
SMART Domains Protein: ENSMUSP00000120749
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
Pfam:CUB 1 63 2.4e-12 PFAM
Pfam:CUB 76 124 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136028
Predicted Effect probably benign
Transcript: ENSMUST00000155251
SMART Domains Protein: ENSMUSP00000121575
Gene: ENSMUSG00000029718

DomainStartEndE-ValueType
CUB 8 111 1.92e-21 SMART
Pfam:CUB 121 169 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196660
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Fbxo24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Fbxo24 APN 5 137624301 missense probably damaging 1.00
IGL01872:Fbxo24 APN 5 137613725 missense probably damaging 1.00
IGL02066:Fbxo24 APN 5 137612870 missense probably damaging 1.00
IGL02078:Fbxo24 APN 5 137624349 missense probably damaging 1.00
IGL02330:Fbxo24 APN 5 137621317 missense probably damaging 1.00
PIT4131001:Fbxo24 UTSW 5 137621902 missense probably damaging 1.00
R0012:Fbxo24 UTSW 5 137621994 missense probably damaging 1.00
R0012:Fbxo24 UTSW 5 137621994 missense probably damaging 1.00
R0243:Fbxo24 UTSW 5 137624557 missense probably damaging 0.98
R0990:Fbxo24 UTSW 5 137618439 missense probably damaging 0.99
R1331:Fbxo24 UTSW 5 137619629 missense probably damaging 1.00
R2139:Fbxo24 UTSW 5 137613065 missense probably damaging 0.99
R5487:Fbxo24 UTSW 5 137618832 missense possibly damaging 0.88
R5954:Fbxo24 UTSW 5 137619681 missense probably damaging 1.00
R5974:Fbxo24 UTSW 5 137619650 missense probably benign 0.12
R6250:Fbxo24 UTSW 5 137621281 missense probably damaging 1.00
R6600:Fbxo24 UTSW 5 137612873 missense probably damaging 1.00
R7345:Fbxo24 UTSW 5 137621261 missense probably damaging 0.99
R7412:Fbxo24 UTSW 5 137619623 missense possibly damaging 0.48
X0064:Fbxo24 UTSW 5 137621236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGAGCCACTCTGTTCCC -3'
(R):5'- GACTTCCTGCAATCATTCAGC -3'

Sequencing Primer
(F):5'- TGTTCCCAGGAAACTCAGCTC -3'
(R):5'- AGCTTTTACCATCACAGGTGGGAC -3'
Posted On2016-10-06