Incidental Mutation 'R5483:Olfr323'
ID434437
Institutional Source Beutler Lab
Gene Symbol Olfr323
Ensembl Gene ENSMUSG00000043880
Gene Nameolfactory receptor 323
SynonymsMOR107-1, GA_x6K02T2NKPP-794386-795357
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58624159-58630501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58625957 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 30 (I30F)
Ref Sequence ENSEMBL: ENSMUSP00000151137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070804] [ENSMUST00000203173] [ENSMUST00000214132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070804
AA Change: I30F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068147
Gene: ENSMUSG00000043880
AA Change: I30F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-54 PFAM
Pfam:7tm_1 41 290 3.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203173
AA Change: I29F

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145459
Gene: ENSMUSG00000043880
AA Change: I29F

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214132
AA Change: I30F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Slc22a3 C T 17: 12,464,467 A170T probably damaging Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Olfr323
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02995:Olfr323 APN 11 58625281 missense possibly damaging 0.92
IGL03118:Olfr323 APN 11 58625443 missense probably damaging 0.99
R0058:Olfr323 UTSW 11 58625668 missense probably damaging 1.00
R0335:Olfr323 UTSW 11 58625740 missense probably damaging 1.00
R1127:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R2029:Olfr323 UTSW 11 58625493 missense probably damaging 1.00
R2434:Olfr323 UTSW 11 58625111 missense possibly damaging 0.95
R6423:Olfr323 UTSW 11 58625363 missense probably damaging 1.00
R6990:Olfr323 UTSW 11 58625458 missense probably damaging 0.98
R7472:Olfr323 UTSW 11 58625434 missense probably damaging 1.00
R7539:Olfr323 UTSW 11 58625956 missense probably damaging 1.00
R7635:Olfr323 UTSW 11 58625164 missense unknown
R7647:Olfr323 UTSW 11 58625203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGTACAGCTGGGCCATG -3'
(R):5'- CAAACTACTGGAGGACCGAC -3'

Sequencing Primer
(F):5'- ACAGCATGTGTCCCCAGGAG -3'
(R):5'- TACTGGAGGACCGACCCTTAGAC -3'
Posted On2016-10-06