Incidental Mutation 'R5483:Slc22a3'
ID434446
Institutional Source Beutler Lab
Gene Symbol Slc22a3
Ensembl Gene ENSMUSG00000023828
Gene Namesolute carrier family 22 (organic cation transporter), member 3
SynonymsOct3, EMT, Orct3
MMRRC Submission 043044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5483 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location12419972-12507704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12464467 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 170 (A170T)
Ref Sequence ENSEMBL: ENSMUSP00000024595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024595]
Predicted Effect probably damaging
Transcript: ENSMUST00000024595
AA Change: A170T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024595
Gene: ENSMUSG00000023828
AA Change: A170T

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 105 526 1.2e-28 PFAM
Pfam:MFS_1 144 395 3.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to paraquat-induced dopamine neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 Q498K probably benign Het
Dnmt3a A G 12: 3,899,615 Y524C probably damaging Het
Dnttip2 A T 3: 122,276,797 T554S probably damaging Het
Emc1 A G 4: 139,375,376 T949A probably damaging Het
Enkur A T 2: 21,194,298 F142I probably benign Het
Fbxo24 C T 5: 137,618,740 A362T probably damaging Het
Heatr1 A G 13: 12,398,914 H124R probably damaging Het
Hira T A 16: 18,969,540 I1011N possibly damaging Het
Ipo5 T A 14: 120,920,038 I96N probably benign Het
Kctd16 A G 18: 40,530,876 I353V probably benign Het
Klf11 T A 12: 24,655,411 L288* probably null Het
Kmt2a A T 9: 44,824,624 probably benign Het
Lmbrd1 T C 1: 24,744,908 Y373H probably damaging Het
Mlh1 G A 9: 111,231,058 A584V possibly damaging Het
Ociad1 T C 5: 73,294,971 F35S probably damaging Het
Olfr1038-ps C T 2: 86,122,618 Q232* probably null Het
Olfr323 T A 11: 58,625,957 I30F possibly damaging Het
Olfr784 T C 10: 129,387,657 I8T probably benign Het
Pkd1l1 C T 11: 8,901,141 probably null Het
Pole T A 5: 110,294,568 D287E probably damaging Het
Polh G T 17: 46,172,745 S531R probably benign Het
Prss29 A G 17: 25,322,203 K207R probably benign Het
Rasgrp3 T G 17: 75,525,018 S611R probably damaging Het
Rffl G T 11: 82,812,723 probably null Het
Scrib A G 15: 76,067,659 probably null Het
Serpinb3a T A 1: 107,047,169 K211N probably benign Het
Socs5 T G 17: 87,134,974 F447L probably damaging Het
Srrm2 T A 17: 23,821,272 S2393T probably damaging Het
Usp7 T A 16: 8,698,540 Y585F probably benign Het
Vps39 A T 2: 120,323,083 I670N probably benign Het
Other mutations in Slc22a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Slc22a3 APN 17 12425610 missense probably damaging 1.00
IGL01343:Slc22a3 APN 17 12425629 missense probably damaging 1.00
IGL01621:Slc22a3 APN 17 12458492 missense probably benign 0.02
IGL02228:Slc22a3 APN 17 12459810 missense probably damaging 1.00
R0466:Slc22a3 UTSW 17 12458493 nonsense probably null
R1501:Slc22a3 UTSW 17 12507104 missense probably benign 0.12
R1688:Slc22a3 UTSW 17 12433807 missense probably damaging 1.00
R3030:Slc22a3 UTSW 17 12457634 missense probably benign 0.00
R4604:Slc22a3 UTSW 17 12459771 missense probably benign 0.38
R4754:Slc22a3 UTSW 17 12507195 missense probably benign 0.03
R4796:Slc22a3 UTSW 17 12423788 missense probably damaging 1.00
R4865:Slc22a3 UTSW 17 12464532 missense probably benign 0.03
R5433:Slc22a3 UTSW 17 12458490 missense probably damaging 1.00
R5719:Slc22a3 UTSW 17 12423804 missense probably damaging 1.00
R5750:Slc22a3 UTSW 17 12433508 missense probably benign 0.01
R5872:Slc22a3 UTSW 17 12433468 missense probably damaging 1.00
R5988:Slc22a3 UTSW 17 12433895 missense possibly damaging 0.92
R6197:Slc22a3 UTSW 17 12458551 missense probably benign 0.00
R7155:Slc22a3 UTSW 17 12433631 missense possibly damaging 0.83
R7764:Slc22a3 UTSW 17 12458496 missense probably damaging 1.00
R7775:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
R7824:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
X0027:Slc22a3 UTSW 17 12458471 missense possibly damaging 0.91
Z1088:Slc22a3 UTSW 17 12425681 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGATGACACTGCCCTCAGG -3'
(R):5'- AAATGTGGTTGCTGTATTAGAGAGTCC -3'

Sequencing Primer
(F):5'- TCAGGTCGAGGCTTTCACCAG -3'
(R):5'- CATGTTTTGAAGATGAACCTCCCTGG -3'
Posted On2016-10-06