Incidental Mutation 'R0490:Lpl'
ID43446
Institutional Source Beutler Lab
Gene Symbol Lpl
Ensembl Gene ENSMUSG00000015568
Gene Namelipoprotein lipase
SynonymsO 1-4-5
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0490 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location68880491-68907448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68896691 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 290 (R290G)
Ref Sequence ENSEMBL: ENSMUSP00000132259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015712] [ENSMUST00000168401]
Predicted Effect probably damaging
Transcript: ENSMUST00000015712
AA Change: R290G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015712
Gene: ENSMUSG00000015568
AA Change: R290G

DomainStartEndE-ValueType
Pfam:Lipase 19 338 7.8e-133 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168401
AA Change: R290G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132259
Gene: ENSMUSG00000015568
AA Change: R290G

DomainStartEndE-ValueType
Pfam:Lipase 19 338 1.1e-117 PFAM
Pfam:Abhydrolase_6 76 264 3e-10 PFAM
LH2 341 465 2.65e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169749
Meta Mutation Damage Score 0.1451 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LPL encodes lipoprotein lipase, which is expressed in heart, muscle, and adipose tissue. LPL functions as a homodimer, and has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. Severe mutations that cause LPL deficiency result in type I hyperlipoproteinemia, while less extreme mutations in LPL are linked to many disorders of lipoprotein metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations become cyanotic and die within 2 days of birth due to chylomicron engorgement of capillaries. Mutants show hypertriglyceridemia and reduced fat stores. Heterozygotes show 1.5-2-fold elevated triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Ap4e1 T A 2: 127,046,186 N404K probably damaging Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Fxn A G 19: 24,277,179 probably null Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Notch4 T A 17: 34,582,890 D1237E probably damaging Het
Olfr1373 A G 11: 52,144,666 I288T probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rita1 A T 5: 120,611,565 F28I probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Slc1a1 A G 19: 28,897,531 K170E probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Lpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Lpl APN 8 68902366 missense probably benign 0.00
IGL01161:Lpl APN 8 68892625 nonsense probably null
IGL01370:Lpl APN 8 68887568 missense possibly damaging 0.92
IGL01420:Lpl APN 8 68887433 splice site probably benign
IGL02034:Lpl APN 8 68880772 missense possibly damaging 0.64
IGL02227:Lpl APN 8 68895800 missense probably damaging 0.99
IGL02949:Lpl APN 8 68892748 missense probably damaging 1.00
IGL03237:Lpl APN 8 68894726 missense possibly damaging 0.90
Bensadoun UTSW 8 68896807 missense probably benign 0.03
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R0064:Lpl UTSW 8 68892704 missense probably damaging 1.00
R1252:Lpl UTSW 8 68892659 missense probably benign 0.03
R1331:Lpl UTSW 8 68896629 missense probably damaging 0.99
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1376:Lpl UTSW 8 68887598 missense probably damaging 1.00
R1444:Lpl UTSW 8 68892747 missense probably damaging 0.99
R1722:Lpl UTSW 8 68896602 frame shift probably null
R1826:Lpl UTSW 8 68902291 missense possibly damaging 0.62
R1867:Lpl UTSW 8 68896602 frame shift probably null
R1874:Lpl UTSW 8 68896619 missense probably damaging 1.00
R1970:Lpl UTSW 8 68896802 nonsense probably null
R2401:Lpl UTSW 8 68901243 missense possibly damaging 0.52
R2516:Lpl UTSW 8 68887518 missense probably benign 0.00
R2850:Lpl UTSW 8 68899512 nonsense probably null
R4688:Lpl UTSW 8 68899425 missense probably damaging 1.00
R4773:Lpl UTSW 8 68896751 missense probably damaging 1.00
R4962:Lpl UTSW 8 68894693 missense probably damaging 1.00
R4993:Lpl UTSW 8 68895793 missense probably benign 0.23
R5343:Lpl UTSW 8 68895737 missense probably damaging 1.00
R6018:Lpl UTSW 8 68901288 missense probably benign
R6082:Lpl UTSW 8 68896649 missense probably damaging 0.98
R6137:Lpl UTSW 8 68892747 missense probably damaging 0.99
R6589:Lpl UTSW 8 68896807 missense probably benign 0.03
R7730:Lpl UTSW 8 68887448 nonsense probably null
R8214:Lpl UTSW 8 68892605 missense probably damaging 1.00
R8274:Lpl UTSW 8 68892598 missense possibly damaging 0.94
R8353:Lpl UTSW 8 68895781 missense probably damaging 1.00
R8453:Lpl UTSW 8 68895781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAAACAACTTCTCCCTCAGGTG -3'
(R):5'- GGCCCATGATAACAGAGATGGCAC -3'

Sequencing Primer
(F):5'- GGGCCAAAAGTTCTTGTCAAC -3'
(R):5'- GAGATGGCACTAAGCAATTTCC -3'
Posted On2013-05-23