Incidental Mutation 'R5308:Romo1'
ID434462
Institutional Source Beutler Lab
Gene Symbol Romo1
Ensembl Gene ENSMUSG00000067847
Gene Namereactive oxygen species modulator 1
Synonyms
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5308 (G1)
Quality Score165
Status Not validated
Chromosome2
Chromosomal Location156144039-156145797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 156144553 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 32 (A32E)
Ref Sequence ENSEMBL: ENSMUSP00000113943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000029149] [ENSMUST00000088610] [ENSMUST00000109587] [ENSMUST00000109597] [ENSMUST00000109598] [ENSMUST00000109600] [ENSMUST00000119950] [ENSMUST00000142071] [ENSMUST00000146297] [ENSMUST00000153514] [ENSMUST00000155837] [ENSMUST00000184469]
Predicted Effect probably benign
Transcript: ENSMUST00000029147
SMART Domains Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 424 6.2e-94 PFAM
Pfam:Beta_elim_lyase 94 344 7.8e-12 PFAM
Pfam:DegT_DnrJ_EryC1 100 250 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029149
SMART Domains Protein: ENSMUSP00000029149
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088610
AA Change: A32E

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085981
Gene: ENSMUSG00000067847
AA Change: A32E

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109587
SMART Domains Protein: ENSMUSP00000105216
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 403 422 N/A INTRINSIC
RRM 425 504 9.44e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109597
AA Change: A32E

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105226
Gene: ENSMUSG00000067847
AA Change: A32E

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109598
AA Change: A32E

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105227
Gene: ENSMUSG00000067847
AA Change: A32E

DomainStartEndE-ValueType
Romo1 13 79 1.34e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109600
SMART Domains Protein: ENSMUSP00000105229
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
Pfam:Aminotran_5 61 118 3.5e-12 PFAM
low complexity region 138 147 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119950
AA Change: A32E

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113943
Gene: ENSMUSG00000067847
AA Change: A32E

DomainStartEndE-ValueType
Pfam:Romo1 13 79 2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125449
Predicted Effect probably benign
Transcript: ENSMUST00000142071
SMART Domains Protein: ENSMUSP00000116820
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
Pfam:RBM39linker 339 404 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146297
SMART Domains Protein: ENSMUSP00000119298
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
low complexity region 28 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
RRM 154 226 2.5e-15 SMART
RRM 251 324 1.39e-31 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 397 416 N/A INTRINSIC
RRM 419 498 9.44e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148794
SMART Domains Protein: ENSMUSP00000117462
Gene: ENSMUSG00000027620

DomainStartEndE-ValueType
RRM 16 88 2.5e-15 SMART
RRM 113 164 2.45e-9 SMART
Pfam:RBM39linker 181 282 6.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153514
Predicted Effect probably benign
Transcript: ENSMUST00000155837
Predicted Effect probably benign
Transcript: ENSMUST00000184469
SMART Domains Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

DomainStartEndE-ValueType
Pfam:Aminotran_5 1 81 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial membrane protein that is responsible for increasing the level of reactive oxygen species (ROS) in cells. The protein also has antimicrobial activity against a variety of bacteria by inducing bacterial membrane breakage. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Romo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1513:Romo1 UTSW 2 156144513 missense probably benign 0.10
R7224:Romo1 UTSW 2 156144375 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTATGTGACCCTGCTGTG -3'
(R):5'- ATTGGCTCTTACAAAAGTGGAGGTAAG -3'

Sequencing Primer
(F):5'- TGACCCTGCTGTGCGTCC -3'
(R):5'- GAGGTAAGTGTCCAGTACTCCAC -3'
Posted On2016-10-06