Incidental Mutation 'R5308:Scyl2'
ID434495
Institutional Source Beutler Lab
Gene Symbol Scyl2
Ensembl Gene ENSMUSG00000069539
Gene NameSCY1-like 2 (S. cerevisiae)
SynonymsCVAK104, D10Ertd802e
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R5308 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location89638721-89686285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89642007 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 710 (I710N)
Ref Sequence ENSEMBL: ENSMUSP00000133992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252]
Predicted Effect probably benign
Transcript: ENSMUST00000092227
AA Change: I709N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: I709N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 9.7e-15 PFAM
Pfam:Pkinase 32 327 4.6e-24 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 679 704 N/A INTRINSIC
low complexity region 896 921 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105294
Predicted Effect probably benign
Transcript: ENSMUST00000174252
AA Change: I710N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: I710N

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 324 6.4e-15 PFAM
Pfam:Pkinase 32 327 2.9e-26 PFAM
low complexity region 356 369 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 897 922 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Matn3 CGGGGCTCGGGGGC CGGGGC 12: 8,952,308 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Scyl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Scyl2 APN 10 89657809 critical splice donor site probably null
IGL01141:Scyl2 APN 10 89640635 missense probably benign
IGL01597:Scyl2 APN 10 89652987 missense probably damaging 0.99
IGL01713:Scyl2 APN 10 89654225 missense probably damaging 1.00
IGL02349:Scyl2 APN 10 89657938 splice site probably benign
IGL02466:Scyl2 APN 10 89653009 nonsense probably null
IGL02511:Scyl2 APN 10 89640819 missense probably benign
IGL02949:Scyl2 APN 10 89660301 missense possibly damaging 0.82
IGL03087:Scyl2 APN 10 89652968 missense possibly damaging 0.93
IGL03117:Scyl2 APN 10 89657867 missense possibly damaging 0.95
IGL03228:Scyl2 APN 10 89650080 missense probably damaging 1.00
R0019:Scyl2 UTSW 10 89659321 missense probably benign 0.44
R0827:Scyl2 UTSW 10 89657865 missense possibly damaging 0.91
R1394:Scyl2 UTSW 10 89640965 missense possibly damaging 0.59
R1460:Scyl2 UTSW 10 89657889 missense possibly damaging 0.90
R1572:Scyl2 UTSW 10 89650956 missense probably damaging 1.00
R1624:Scyl2 UTSW 10 89640736 missense probably benign 0.19
R1909:Scyl2 UTSW 10 89640905 missense probably benign 0.01
R3846:Scyl2 UTSW 10 89640541 missense probably damaging 1.00
R4041:Scyl2 UTSW 10 89650052 missense probably damaging 1.00
R4077:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4079:Scyl2 UTSW 10 89640596 missense probably benign 0.01
R4765:Scyl2 UTSW 10 89659298 missense probably damaging 0.97
R4855:Scyl2 UTSW 10 89640463 utr 3 prime probably benign
R5894:Scyl2 UTSW 10 89640819 missense probably benign
R5901:Scyl2 UTSW 10 89660262 missense probably benign 0.03
R6048:Scyl2 UTSW 10 89645486 missense probably benign 0.33
R6249:Scyl2 UTSW 10 89657857 missense possibly damaging 0.93
R6658:Scyl2 UTSW 10 89640973 missense probably benign 0.01
R6827:Scyl2 UTSW 10 89669804 critical splice acceptor site probably null
R6909:Scyl2 UTSW 10 89645742 missense probably benign 0.28
R7027:Scyl2 UTSW 10 89645461 critical splice donor site probably null
R7095:Scyl2 UTSW 10 89669687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTGGTTGCCAGCACTGAG -3'
(R):5'- ACTGCTAAGTGAACTGTGGTAC -3'

Sequencing Primer
(F):5'- CACTGAGACTGAACCTTGCATGTG -3'
(R):5'- TGGTACACATTCCTTACCACAAACG -3'
Posted On2016-10-06