Incidental Mutation 'R5308:Matn3'
ID434505
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Namematrilin 3
Synonyms
MMRRC Submission 042891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5308 (G1)
Quality Score217
Status Not validated
Chromosome12
Chromosomal Location8947929-8972028 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGGGGCTCGGGGGC to CGGGGC at 8952308 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
Predicted Effect probably null
Transcript: ENSMUST00000020899
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.7%
  • 10x: 95.4%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik T C 2: 19,524,081 D163G probably damaging Het
4931406P16Rik T A 7: 34,245,755 K355* probably null Het
Abcd4 C T 12: 84,603,293 probably null Het
Alg9 T C 9: 50,822,711 S570P possibly damaging Het
Angptl3 C A 4: 99,034,486 H255N probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Cdc37 A T 9: 21,140,764 D326E probably benign Het
Cdk13 T C 13: 17,772,313 K6R probably damaging Het
Ces1b T C 8: 93,067,017 K315E probably benign Het
Cfap61 G A 2: 146,109,988 G190S probably damaging Het
Ckap4 T C 10: 84,528,374 E275G probably benign Het
Csf3r A G 4: 126,035,344 D349G probably benign Het
Cyp2d37-ps T C 15: 82,689,811 noncoding transcript Het
Dmbt1 T A 7: 131,041,021 C190S probably damaging Het
Dnah11 A G 12: 118,085,680 F1670L possibly damaging Het
Dnah5 A T 15: 28,229,651 I144F possibly damaging Het
Eno2 C A 6: 124,767,093 V84L probably damaging Het
Ercc4 G T 16: 13,130,164 R325L probably damaging Het
Fam71e1 T C 7: 44,500,182 V109A probably damaging Het
Fcgr2b T G 1: 170,965,710 Q250P probably benign Het
Gcfc2 T C 6: 81,943,543 probably null Het
Glb1l2 C T 9: 26,764,759 G509D probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Grn A G 11: 102,436,192 N160D possibly damaging Het
Hexdc T A 11: 121,222,269 V510D probably damaging Het
Igfbp1 G A 11: 7,199,919 probably null Het
Itga11 T A 9: 62,755,769 M589K probably benign Het
Itpr1 A T 6: 108,356,511 S51C probably damaging Het
Klra3 T C 6: 130,334,307 probably null Het
Mad2l1 T C 6: 66,537,691 probably null Het
Myo9a T A 9: 59,863,961 Y939N probably damaging Het
Nxpe3 C T 16: 55,866,471 S58N probably benign Het
Olfr1195 T C 2: 88,683,405 E109G probably benign Het
Olfr1295 C T 2: 111,564,554 A297T probably damaging Het
Olfr345 T A 2: 36,640,694 Y218* probably null Het
Olfr402 T A 11: 74,155,571 M139K probably damaging Het
Paics T C 5: 76,956,632 S35P probably damaging Het
Pcnt A C 10: 76,356,325 Y2717* probably null Het
Pifo T C 3: 106,001,103 T107A probably benign Het
Plekho2 T A 9: 65,558,675 N144Y probably damaging Het
Plscr5 T C 9: 92,198,512 F17S possibly damaging Het
Prrc2a C T 17: 35,161,047 R192H unknown Het
Rbm27 T A 18: 42,327,210 M735K probably damaging Het
Rfc1 T A 5: 65,279,461 K625N probably damaging Het
Ric8b T A 10: 84,947,747 F156L probably benign Het
Romo1 C A 2: 156,144,553 A32E possibly damaging Het
Rpl26 T A 11: 68,904,458 Y135N probably damaging Het
Sacs T C 14: 61,192,400 V636A probably benign Het
Scyl2 A T 10: 89,642,007 I710N probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc4a1 T A 11: 102,359,077 I154F probably damaging Het
Snx11 A G 11: 96,770,709 S157P probably damaging Het
Snx18 G A 13: 113,616,847 Q517* probably null Het
Stard4 G T 18: 33,203,625 N212K probably damaging Het
Strn3 A G 12: 51,629,385 Y454H probably damaging Het
Stx17 A T 4: 48,182,851 probably benign Het
Tas2r121 G A 6: 132,700,517 T164I possibly damaging Het
Tbc1d8 T C 1: 39,389,409 Y485C probably damaging Het
Tmem45b T C 9: 31,429,084 M8V probably damaging Het
Usp28 T C 9: 49,037,201 F844L probably damaging Het
Usp32 T A 11: 85,017,718 N1054I probably benign Het
Xpa T A 4: 46,185,659 E106D probably benign Het
Zfp85 C T 13: 67,748,855 C366Y probably damaging Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 8952091 missense probably damaging 0.98
IGL02138:Matn3 APN 12 8967638 missense possibly damaging 0.93
IGL02442:Matn3 APN 12 8967678 nonsense probably null
IGL02736:Matn3 APN 12 8955422 missense possibly damaging 0.53
R0091:Matn3 UTSW 12 8952105 missense probably damaging 0.98
R0585:Matn3 UTSW 12 8961103 splice site probably benign
R0615:Matn3 UTSW 12 8963594 missense probably damaging 1.00
R1424:Matn3 UTSW 12 8961132 missense possibly damaging 0.91
R1571:Matn3 UTSW 12 8955466 missense probably damaging 1.00
R1844:Matn3 UTSW 12 8967662 missense possibly damaging 0.90
R1865:Matn3 UTSW 12 8952041 missense probably damaging 1.00
R1977:Matn3 UTSW 12 8961110 splice site probably benign
R3015:Matn3 UTSW 12 8952217 missense probably damaging 0.97
R3018:Matn3 UTSW 12 8963578 missense probably benign 0.02
R5180:Matn3 UTSW 12 8955374 missense probably benign 0.38
R5616:Matn3 UTSW 12 8948195 missense probably benign
R5816:Matn3 UTSW 12 8970571 missense probably damaging 1.00
R5849:Matn3 UTSW 12 8958829 missense probably benign 0.10
R7065:Matn3 UTSW 12 8952472 missense probably damaging 0.99
R7206:Matn3 UTSW 12 8961170 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTGGTGAACTATGCCAGC -3'
(R):5'- GCAGAAAGCTTCTCAATGACC -3'

Sequencing Primer
(F):5'- TGAACTATGCCAGCACTGTG -3'
(R):5'- CGTAGGTCTCCACGTAGAAGAC -3'
Posted On2016-10-06