Incidental Mutation 'R5357:Hsd17b12'
ID434526
Institutional Source Beutler Lab
Gene Symbol Hsd17b12
Ensembl Gene ENSMUSG00000027195
Gene Namehydroxysteroid (17-beta) dehydrogenase 12
Synonymskeratonectin, keratoadhesin, 2610510O05Rik, KIK-I
MMRRC Submission 042936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5357 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location94032689-94157964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94033645 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 284 (I284T)
Ref Sequence ENSEMBL: ENSMUSP00000028619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028619]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028619
AA Change: I284T

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028619
Gene: ENSMUSG00000027195
AA Change: I284T

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:adh_short 51 248 1.5e-46 PFAM
Pfam:KR 52 125 4.4e-7 PFAM
Pfam:adh_short_C2 57 277 7.5e-10 PFAM
low complexity region 298 312 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146580
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a very important 17beta-hydroxysteroid dehydrogenase (17beta-HSD) that converts estrone into estradiol in ovarian tissue. This enzyme is also involved in fatty acid elongation. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit die around E8.5 with abnormal embryonic and extraembryonic tissue development. ES cells heterozygous for this allele exhibit reduced arachidonic acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,152 V206A possibly damaging Het
5730522E02Rik A T 11: 25,648,148 C102* probably null Het
Brsk2 C A 7: 141,984,511 D131E possibly damaging Het
Cacng7 T C 7: 3,338,936 F112L probably benign Het
Ceacam12 T A 7: 18,077,459 C282* probably null Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Dyrk1b T C 7: 28,185,318 V326A possibly damaging Het
Eloa T C 4: 136,009,248 D563G probably benign Het
Evi5l A G 8: 4,203,623 K489R possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Galntl6 T C 8: 57,884,463 E326G probably damaging Het
Gm1758 G A 16: 14,502,354 noncoding transcript Het
Grm8 A T 6: 27,762,419 L269Q probably damaging Het
Hyal6 T A 6: 24,734,518 M150K probably benign Het
Ift80 T A 3: 68,990,780 Q74L possibly damaging Het
Krt76 T C 15: 101,887,385 K450R probably benign Het
Larp1b A G 3: 41,024,515 E2G probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map2k7 A T 8: 4,244,461 H253L probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mmp2 A G 8: 92,833,152 T248A possibly damaging Het
Mt1 T A 8: 94,180,104 C33S probably damaging Het
Obox5 T A 7: 15,757,538 M1K probably null Het
Pak4 A G 7: 28,564,406 S302P probably damaging Het
Pcsk2 T C 2: 143,573,464 Y66H probably benign Het
Pgm3 G A 9: 86,556,257 R451* probably null Het
Phf10 A T 17: 14,954,013 probably null Het
Pkd1 T G 17: 24,565,790 V402G probably damaging Het
Plekha4 G T 7: 45,534,771 V61F probably damaging Het
Ppfia2 G A 10: 106,904,847 probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Skil A G 3: 31,113,551 H444R probably benign Het
Tcn2 T G 11: 3,926,017 D137A possibly damaging Het
Tnks2 G A 19: 36,849,290 silent Het
Trh T A 6: 92,242,834 D167V probably benign Het
Tshz1 C T 18: 84,015,080 G401D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl T A 7: 104,148,931 Q453L probably damaging Het
Vmn2r111 T A 17: 22,548,102 K805* probably null Het
Wnt16 T G 6: 22,291,232 probably benign Het
Zc3h11a A T 1: 133,623,042 V665E probably damaging Het
Zfp456 A T 13: 67,372,209 M63K possibly damaging Het
Zzef1 C T 11: 72,843,333 Q584* probably null Het
Other mutations in Hsd17b12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Hsd17b12 APN 2 94083165 critical splice donor site probably null
IGL00785:Hsd17b12 APN 2 94045414 missense probably damaging 1.00
IGL02230:Hsd17b12 APN 2 94045398 missense possibly damaging 0.94
IGL02635:Hsd17b12 APN 2 94083211 missense possibly damaging 0.93
IGL03094:Hsd17b12 APN 2 94033994 missense probably damaging 1.00
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0242:Hsd17b12 UTSW 2 94157815 missense probably benign 0.14
R0390:Hsd17b12 UTSW 2 94114990 splice site probably benign
R0552:Hsd17b12 UTSW 2 94043935 missense probably damaging 1.00
R0605:Hsd17b12 UTSW 2 94033642 missense probably benign 0.00
R1585:Hsd17b12 UTSW 2 94033976 missense probably damaging 1.00
R1681:Hsd17b12 UTSW 2 94033561 missense unknown
R1922:Hsd17b12 UTSW 2 94045392 missense probably benign 0.00
R2190:Hsd17b12 UTSW 2 94034063 missense probably benign 0.02
R2384:Hsd17b12 UTSW 2 94033619 missense probably benign
R3123:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3124:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R3125:Hsd17b12 UTSW 2 94033958 missense probably benign 0.03
R4283:Hsd17b12 UTSW 2 94033586 missense unknown
R5218:Hsd17b12 UTSW 2 94083263 missense probably benign 0.02
R6020:Hsd17b12 UTSW 2 94033977 missense probably damaging 1.00
R6493:Hsd17b12 UTSW 2 94043883 missense probably damaging 1.00
R7792:Hsd17b12 UTSW 2 94033641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTGAAGACTCTGGGGAC -3'
(R):5'- GTGATCCACTCTCTCATGGTATGTAC -3'

Sequencing Primer
(F):5'- TGGGGACAGGCAGGTGC -3'
(R):5'- CTTAAACATATTTTCCAGTTTGGGC -3'
Posted On2016-10-06