Incidental Mutation 'R5357:1700013G24Rik'
ID434533
Institutional Source Beutler Lab
Gene Symbol 1700013G24Rik
Ensembl Gene ENSMUSG00000041399
Gene NameRIKEN cDNA 1700013G24 gene
Synonyms
MMRRC Submission 042936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5357 (G1)
Quality Score196
Status Not validated
Chromosome4
Chromosomal Location137453284-137455461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137455152 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 206 (V206A)
Ref Sequence ENSEMBL: ENSMUSP00000043461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048893
AA Change: V206A

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043461
Gene: ENSMUSG00000041399
AA Change: V206A

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 181 203 N/A INTRINSIC
SCOP:d1i50b_ 216 261 3e-3 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A T 11: 25,648,148 C102* probably null Het
Brsk2 C A 7: 141,984,511 D131E possibly damaging Het
Cacng7 T C 7: 3,338,936 F112L probably benign Het
Ceacam12 T A 7: 18,077,459 C282* probably null Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Dyrk1b T C 7: 28,185,318 V326A possibly damaging Het
Eloa T C 4: 136,009,248 D563G probably benign Het
Evi5l A G 8: 4,203,623 K489R possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Galntl6 T C 8: 57,884,463 E326G probably damaging Het
Gm1758 G A 16: 14,502,354 noncoding transcript Het
Grm8 A T 6: 27,762,419 L269Q probably damaging Het
Hsd17b12 A G 2: 94,033,645 I284T possibly damaging Het
Hyal6 T A 6: 24,734,518 M150K probably benign Het
Ift80 T A 3: 68,990,780 Q74L possibly damaging Het
Krt76 T C 15: 101,887,385 K450R probably benign Het
Larp1b A G 3: 41,024,515 E2G probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map2k7 A T 8: 4,244,461 H253L probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mmp2 A G 8: 92,833,152 T248A possibly damaging Het
Mt1 T A 8: 94,180,104 C33S probably damaging Het
Obox5 T A 7: 15,757,538 M1K probably null Het
Pak4 A G 7: 28,564,406 S302P probably damaging Het
Pcsk2 T C 2: 143,573,464 Y66H probably benign Het
Pgm3 G A 9: 86,556,257 R451* probably null Het
Phf10 A T 17: 14,954,013 probably null Het
Pkd1 T G 17: 24,565,790 V402G probably damaging Het
Plekha4 G T 7: 45,534,771 V61F probably damaging Het
Ppfia2 G A 10: 106,904,847 probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Skil A G 3: 31,113,551 H444R probably benign Het
Tcn2 T G 11: 3,926,017 D137A possibly damaging Het
Tnks2 G A 19: 36,849,290 silent Het
Trh T A 6: 92,242,834 D167V probably benign Het
Tshz1 C T 18: 84,015,080 G401D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl T A 7: 104,148,931 Q453L probably damaging Het
Vmn2r111 T A 17: 22,548,102 K805* probably null Het
Wnt16 T G 6: 22,291,232 probably benign Het
Zc3h11a A T 1: 133,623,042 V665E probably damaging Het
Zfp456 A T 13: 67,372,209 M63K possibly damaging Het
Zzef1 C T 11: 72,843,333 Q584* probably null Het
Other mutations in 1700013G24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:1700013G24Rik APN 4 137455262 missense possibly damaging 0.82
IGL02646:1700013G24Rik APN 4 137454790 nonsense probably null
R0526:1700013G24Rik UTSW 4 137455224 missense possibly damaging 0.92
R1449:1700013G24Rik UTSW 4 137455355 missense possibly damaging 0.94
R3743:1700013G24Rik UTSW 4 137455037 missense probably damaging 0.96
R6265:1700013G24Rik UTSW 4 137454675 missense probably damaging 1.00
R6586:1700013G24Rik UTSW 4 137455328 missense possibly damaging 0.90
R6720:1700013G24Rik UTSW 4 137454686 missense possibly damaging 0.94
R6988:1700013G24Rik UTSW 4 137454579 missense probably damaging 1.00
R7640:1700013G24Rik UTSW 4 137454594 missense probably damaging 0.99
R7825:1700013G24Rik UTSW 4 137455343 missense probably damaging 1.00
Z1176:1700013G24Rik UTSW 4 137454992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCATCAAAGGCATTAGC -3'
(R):5'- ACTTGGGCAGACGACCTAAG -3'

Sequencing Primer
(F):5'- GGCATTAGCTACCTGGACAGATC -3'
(R):5'- CCTAAGGAGAAGAACCCGTTGC -3'
Posted On2016-10-06