Incidental Mutation 'R0490:Olfr1373'
ID43454
Institutional Source Beutler Lab
Gene Symbol Olfr1373
Ensembl Gene ENSMUSG00000062204
Gene Nameolfactory receptor 1373
SynonymsMOR256-69_p, GA_x6K02T2QP88-3283154-3284089
MMRRC Submission 038688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0490 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location52144593-52145528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52144666 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 288 (I288T)
Ref Sequence ENSEMBL: ENSMUSP00000077384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078264]
Predicted Effect probably damaging
Transcript: ENSMUST00000078264
AA Change: I288T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077384
Gene: ENSMUSG00000062204
AA Change: I288T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 4.7e-46 PFAM
Pfam:7tm_1 41 289 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.4012 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T A 10: 29,227,342 Y640N probably damaging Het
Adamts9 T A 6: 92,872,866 Q402L probably benign Het
Als2cl A G 9: 110,895,346 T750A probably benign Het
Ank1 C A 8: 23,107,874 probably benign Het
Ap4e1 T A 2: 127,046,186 N404K probably damaging Het
Atf7ip G T 6: 136,609,192 probably benign Het
Bean1 A T 8: 104,215,028 T169S possibly damaging Het
Bod1l G T 5: 41,821,892 T693N probably damaging Het
Ccdc81 A T 7: 89,887,762 V226D probably benign Het
Cd48 A G 1: 171,704,877 *241W probably null Het
Cdon C A 9: 35,452,682 S32Y probably damaging Het
Cers3 A G 7: 66,773,690 S128G possibly damaging Het
Cntn6 T C 6: 104,833,918 V641A possibly damaging Het
Col6a4 G A 9: 106,013,770 T1775I probably damaging Het
Dnah8 T C 17: 30,700,419 V1122A probably benign Het
Dst G T 1: 34,307,368 G5102* probably null Het
Dvl3 C T 16: 20,527,423 probably benign Het
Epha5 G T 5: 84,107,974 probably benign Het
Fscb G A 12: 64,472,887 P602S unknown Het
Fxn A G 19: 24,277,179 probably null Het
Gipc2 A G 3: 152,102,654 L254P possibly damaging Het
Gm973 C T 1: 59,558,234 probably benign Het
Gng8 A G 7: 16,894,983 T14A probably benign Het
Gsdmc3 C T 15: 63,860,250 G309D possibly damaging Het
Gsr T A 8: 33,671,512 probably benign Het
Gtdc1 A T 2: 44,635,040 D152E probably benign Het
Herc1 A G 9: 66,484,999 D4063G probably damaging Het
Hsdl2 C T 4: 59,612,814 probably benign Het
Iqgap3 T C 3: 88,114,056 probably benign Het
Kcnj10 A G 1: 172,369,452 T178A probably damaging Het
Lama5 T A 2: 180,180,169 I2958F possibly damaging Het
Lnx1 T A 5: 74,620,347 probably null Het
Lpl A G 8: 68,896,691 R290G probably damaging Het
Mamdc4 C T 2: 25,563,581 R1196K probably benign Het
Mogat2 T C 7: 99,223,144 S167G probably benign Het
Nek8 T A 11: 78,167,729 I582F probably benign Het
Notch4 T A 17: 34,582,890 D1237E probably damaging Het
Olfr1457 A G 19: 13,094,812 Y279H probably damaging Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Olfr1499 A G 19: 13,814,855 L245P probably damaging Het
Pcdhb8 T C 18: 37,356,780 S504P probably damaging Het
Pigs T C 11: 78,335,625 S223P probably damaging Het
Prkch A G 12: 73,759,676 I566V probably damaging Het
Ptpn22 T C 3: 103,886,179 S549P probably damaging Het
Rita1 A T 5: 120,611,565 F28I probably damaging Het
Rpgrip1l A T 8: 91,299,845 probably benign Het
Slc1a1 A G 19: 28,897,531 K170E probably benign Het
Spag17 C T 3: 99,982,411 R199W probably damaging Het
Tas2r116 T C 6: 132,856,021 V195A probably benign Het
Trav7d-3 C A 14: 52,744,550 probably benign Het
Trim15 T C 17: 36,866,355 K138E probably benign Het
Ttn T A 2: 76,708,830 H34604L probably benign Het
Ttn C T 2: 76,747,532 R16012K probably damaging Het
Zfp948 T C 17: 21,588,034 V496A probably benign Het
Zfy2 A T Y: 2,106,620 S671R possibly damaging Het
Zswim1 T A 2: 164,825,283 Y152N possibly damaging Het
Other mutations in Olfr1373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02277:Olfr1373 APN 11 52145362 missense probably damaging 0.97
IGL02814:Olfr1373 APN 11 52144810 missense probably damaging 1.00
R1075:Olfr1373 UTSW 11 52144850 missense possibly damaging 0.94
R4050:Olfr1373 UTSW 11 52145134 missense probably damaging 1.00
R5666:Olfr1373 UTSW 11 52144698 nonsense probably null
R6267:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6296:Olfr1373 UTSW 11 52144596 missense probably benign 0.28
R6720:Olfr1373 UTSW 11 52144693 missense probably benign 0.18
R6887:Olfr1373 UTSW 11 52145352 missense probably benign 0.01
V1662:Olfr1373 UTSW 11 52145177 missense probably damaging 1.00
X0066:Olfr1373 UTSW 11 52145264 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGAGGTCGAGATAAGTCCAGTGC -3'
(R):5'- AGGCTCCTATGCTCACATTGCCAG -3'

Sequencing Primer
(F):5'- agtaatggaattagcaaaaagtggg -3'
(R):5'- TGCTGAACATCAGGTCAGTGG -3'
Posted On2013-05-23