Incidental Mutation 'R5357:Pak4'
ID434543
Institutional Source Beutler Lab
Gene Symbol Pak4
Ensembl Gene ENSMUSG00000030602
Gene Namep21 (RAC1) activated kinase 4
Synonyms
MMRRC Submission 042936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5357 (G1)
Quality Score186
Status Not validated
Chromosome7
Chromosomal Location28558819-28598185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28564406 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 302 (S302P)
Ref Sequence ENSEMBL: ENSMUSP00000103918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032823] [ENSMUST00000040531] [ENSMUST00000108283]
Predicted Effect probably damaging
Transcript: ENSMUST00000032823
AA Change: S302P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032823
Gene: ENSMUSG00000030602
AA Change: S302P

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108283
AA Change: S302P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103918
Gene: ENSMUSG00000030602
AA Change: S302P

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183983
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die at midgestation exhibiting heart defects as well as impaired neuronal development and yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,152 V206A possibly damaging Het
5730522E02Rik A T 11: 25,648,148 C102* probably null Het
Brsk2 C A 7: 141,984,511 D131E possibly damaging Het
Cacng7 T C 7: 3,338,936 F112L probably benign Het
Ceacam12 T A 7: 18,077,459 C282* probably null Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Dyrk1b T C 7: 28,185,318 V326A possibly damaging Het
Eloa T C 4: 136,009,248 D563G probably benign Het
Evi5l A G 8: 4,203,623 K489R possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Galntl6 T C 8: 57,884,463 E326G probably damaging Het
Gm1758 G A 16: 14,502,354 noncoding transcript Het
Grm8 A T 6: 27,762,419 L269Q probably damaging Het
Hsd17b12 A G 2: 94,033,645 I284T possibly damaging Het
Hyal6 T A 6: 24,734,518 M150K probably benign Het
Ift80 T A 3: 68,990,780 Q74L possibly damaging Het
Krt76 T C 15: 101,887,385 K450R probably benign Het
Larp1b A G 3: 41,024,515 E2G probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map2k7 A T 8: 4,244,461 H253L probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mmp2 A G 8: 92,833,152 T248A possibly damaging Het
Mt1 T A 8: 94,180,104 C33S probably damaging Het
Obox5 T A 7: 15,757,538 M1K probably null Het
Pcsk2 T C 2: 143,573,464 Y66H probably benign Het
Pgm3 G A 9: 86,556,257 R451* probably null Het
Phf10 A T 17: 14,954,013 probably null Het
Pkd1 T G 17: 24,565,790 V402G probably damaging Het
Plekha4 G T 7: 45,534,771 V61F probably damaging Het
Ppfia2 G A 10: 106,904,847 probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Skil A G 3: 31,113,551 H444R probably benign Het
Tcn2 T G 11: 3,926,017 D137A possibly damaging Het
Tnks2 G A 19: 36,849,290 silent Het
Trh T A 6: 92,242,834 D167V probably benign Het
Tshz1 C T 18: 84,015,080 G401D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl T A 7: 104,148,931 Q453L probably damaging Het
Vmn2r111 T A 17: 22,548,102 K805* probably null Het
Wnt16 T G 6: 22,291,232 probably benign Het
Zc3h11a A T 1: 133,623,042 V665E probably damaging Het
Zfp456 A T 13: 67,372,209 M63K possibly damaging Het
Zzef1 C T 11: 72,843,333 Q584* probably null Het
Other mutations in Pak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0025:Pak4 UTSW 7 28564283 missense probably damaging 1.00
R0531:Pak4 UTSW 7 28568054 missense possibly damaging 0.69
R0893:Pak4 UTSW 7 28559777 missense probably benign 0.21
R1108:Pak4 UTSW 7 28560242 missense probably damaging 1.00
R1801:Pak4 UTSW 7 28565190 missense probably damaging 1.00
R1844:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R3108:Pak4 UTSW 7 28564344 nonsense probably null
R4693:Pak4 UTSW 7 28564249 missense probably damaging 1.00
R5320:Pak4 UTSW 7 28568206 missense probably damaging 0.98
R5724:Pak4 UTSW 7 28564580 missense possibly damaging 0.94
R6047:Pak4 UTSW 7 28563036 missense probably benign 0.34
R6161:Pak4 UTSW 7 28565267 missense possibly damaging 0.95
R6241:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R6820:Pak4 UTSW 7 28563036 missense probably benign 0.34
R7262:Pak4 UTSW 7 28565200 missense possibly damaging 0.60
R7338:Pak4 UTSW 7 28564956 missense probably benign 0.37
R7681:Pak4 UTSW 7 28560230 missense probably damaging 1.00
R8709:Pak4 UTSW 7 28562544 missense probably benign 0.02
Z1088:Pak4 UTSW 7 28565228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCGCAAGTCCATCTTCTTG -3'
(R):5'- ACATACCATGGCCCCTAATGG -3'

Sequencing Primer
(F):5'- TTGACGGCCACCAGTTTG -3'
(R):5'- CTGGCCGCTCCTCAGTC -3'
Posted On2016-10-06