Incidental Mutation 'R5357:Plekha4'
ID 434544
Institutional Source Beutler Lab
Gene Symbol Plekha4
Ensembl Gene ENSMUSG00000040428
Gene Name pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms 2410005C22Rik, PEPP1
MMRRC Submission 042936-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R5357 (G1)
Quality Score 213
Status Not validated
Chromosome 7
Chromosomal Location 45175754-45203653 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45184195 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 61 (V61F)
Ref Sequence ENSEMBL: ENSMUSP00000147344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051810] [ENSMUST00000209517] [ENSMUST00000211155] [ENSMUST00000211797] [ENSMUST00000211227] [ENSMUST00000210480]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051810
AA Change: V132F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051468
Gene: ENSMUSG00000040428
AA Change: V132F

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120516
AA Change: V132F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114138
Gene: ENSMUSG00000040428
AA Change: V132F

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 308 328 N/A INTRINSIC
coiled coil region 348 391 N/A INTRINSIC
low complexity region 491 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120985
AA Change: V132F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112856
Gene: ENSMUSG00000040428
AA Change: V132F

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121932
AA Change: V132F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113802
Gene: ENSMUSG00000040428
AA Change: V132F

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
PH 55 155 8.18e-19 SMART
low complexity region 162 190 N/A INTRINSIC
low complexity region 228 260 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 321 334 N/A INTRINSIC
coiled coil region 376 419 N/A INTRINSIC
low complexity region 519 535 N/A INTRINSIC
low complexity region 608 628 N/A INTRINSIC
low complexity region 649 659 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149052
AA Change: V61F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123030
Gene: ENSMUSG00000040428
AA Change: V61F

DomainStartEndE-ValueType
Blast:PH 49 84 4e-13 BLAST
PDB:1UPR|A 49 89 2e-16 PDB
SCOP:d1btn__ 54 80 1e-4 SMART
low complexity region 91 119 N/A INTRINSIC
low complexity region 157 189 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
low complexity region 250 263 N/A INTRINSIC
coiled coil region 305 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209517
AA Change: V132F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211155
AA Change: V132F

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000211797
AA Change: V61F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211227
AA Change: V132F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210480
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,182,463 (GRCm39) V206A possibly damaging Het
5730522E02Rik A T 11: 25,598,148 (GRCm39) C102* probably null Het
Brsk2 C A 7: 141,538,248 (GRCm39) D131E possibly damaging Het
Cacng7 T C 7: 3,387,452 (GRCm39) F112L probably benign Het
Ceacam12 T A 7: 17,811,384 (GRCm39) C282* probably null Het
Dnm1 T C 2: 32,226,253 (GRCm39) D312G probably null Het
Dyrk1b T C 7: 27,884,743 (GRCm39) V326A possibly damaging Het
Eloa T C 4: 135,736,559 (GRCm39) D563G probably benign Het
Evi5l A G 8: 4,253,623 (GRCm39) K489R possibly damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
Galntl6 T C 8: 58,337,497 (GRCm39) E326G probably damaging Het
Gm1758 G A 16: 14,320,218 (GRCm39) noncoding transcript Het
Grm8 A T 6: 27,762,418 (GRCm39) L269Q probably damaging Het
Hsd17b12 A G 2: 93,863,990 (GRCm39) I284T possibly damaging Het
Hyal6 T A 6: 24,734,517 (GRCm39) M150K probably benign Het
Ift80 T A 3: 68,898,113 (GRCm39) Q74L possibly damaging Het
Krt76 T C 15: 101,795,820 (GRCm39) K450R probably benign Het
Larp1b A G 3: 40,978,950 (GRCm39) E2G probably benign Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Map2k7 A T 8: 4,294,461 (GRCm39) H253L probably damaging Het
Melk C T 4: 44,363,730 (GRCm39) T592M probably damaging Het
Mmp2 A G 8: 93,559,780 (GRCm39) T248A possibly damaging Het
Mt1 T A 8: 94,906,732 (GRCm39) C33S probably damaging Het
Obox5 T A 7: 15,491,463 (GRCm39) M1K probably null Het
Pak4 A G 7: 28,263,831 (GRCm39) S302P probably damaging Het
Pcsk2 T C 2: 143,415,384 (GRCm39) Y66H probably benign Het
Pgm3 G A 9: 86,438,310 (GRCm39) R451* probably null Het
Phf10 A T 17: 15,174,275 (GRCm39) probably null Het
Pkd1 T G 17: 24,784,764 (GRCm39) V402G probably damaging Het
Ppfia2 G A 10: 106,740,708 (GRCm39) probably null Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Skil A G 3: 31,167,700 (GRCm39) H444R probably benign Het
Tcn2 T G 11: 3,876,017 (GRCm39) D137A possibly damaging Het
Tnks2 G A 19: 36,826,690 (GRCm39) silent Het
Trh T A 6: 92,219,815 (GRCm39) D167V probably benign Het
Tshz1 C T 18: 84,033,205 (GRCm39) G401D probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqlnl T A 7: 103,798,138 (GRCm39) Q453L probably damaging Het
Vmn2r111 T A 17: 22,767,083 (GRCm39) K805* probably null Het
Wnt16 T G 6: 22,291,231 (GRCm39) probably benign Het
Zc3h11a A T 1: 133,550,780 (GRCm39) V665E probably damaging Het
Zfp456 A T 13: 67,520,328 (GRCm39) M63K possibly damaging Het
Zzef1 C T 11: 72,734,159 (GRCm39) Q584* probably null Het
Other mutations in Plekha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Plekha4 APN 7 45,187,659 (GRCm39) missense probably damaging 0.97
IGL01716:Plekha4 APN 7 45,183,767 (GRCm39) missense probably damaging 0.98
IGL02072:Plekha4 APN 7 45,187,722 (GRCm39) missense probably benign 0.29
IGL02815:Plekha4 APN 7 45,187,836 (GRCm39) missense probably damaging 1.00
IGL02939:Plekha4 APN 7 45,181,787 (GRCm39) nonsense probably null
PIT4494001:Plekha4 UTSW 7 45,197,503 (GRCm39) missense probably damaging 1.00
R0085:Plekha4 UTSW 7 45,193,373 (GRCm39) nonsense probably null
R0239:Plekha4 UTSW 7 45,181,782 (GRCm39) missense probably damaging 1.00
R0239:Plekha4 UTSW 7 45,181,782 (GRCm39) missense probably damaging 1.00
R1036:Plekha4 UTSW 7 45,199,400 (GRCm39) splice site probably benign
R1955:Plekha4 UTSW 7 45,203,330 (GRCm39) missense probably damaging 0.99
R2049:Plekha4 UTSW 7 45,203,222 (GRCm39) missense probably benign 0.01
R2187:Plekha4 UTSW 7 45,198,698 (GRCm39) missense probably damaging 0.99
R2888:Plekha4 UTSW 7 45,187,668 (GRCm39) missense probably damaging 1.00
R5086:Plekha4 UTSW 7 45,203,082 (GRCm39) missense possibly damaging 0.82
R5604:Plekha4 UTSW 7 45,198,580 (GRCm39) missense probably damaging 0.96
R5611:Plekha4 UTSW 7 45,203,065 (GRCm39) missense probably benign
R6255:Plekha4 UTSW 7 45,203,226 (GRCm39) utr 3 prime probably benign
R6341:Plekha4 UTSW 7 45,190,572 (GRCm39) missense probably damaging 1.00
R6502:Plekha4 UTSW 7 45,180,000 (GRCm39) start codon destroyed probably null 0.87
R6720:Plekha4 UTSW 7 45,190,310 (GRCm39) missense possibly damaging 0.86
R6776:Plekha4 UTSW 7 45,184,241 (GRCm39) missense probably damaging 1.00
R8057:Plekha4 UTSW 7 45,198,695 (GRCm39) missense probably benign
R9095:Plekha4 UTSW 7 45,190,492 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCGATTCACCTTCACAGTGAG -3'
(R):5'- AGATCAGTCGGGAGTCTTGG -3'

Sequencing Primer
(F):5'- CAGTGAGTCTGTTTGTGGATGCTAG -3'
(R):5'- AGAGAACCCCTTTTTGCTATTGGAG -3'
Posted On 2016-10-06