Incidental Mutation 'R5357:Tcn2'
ID434554
Institutional Source Beutler Lab
Gene Symbol Tcn2
Ensembl Gene ENSMUSG00000020432
Gene Nametranscobalamin 2
SynonymsTcn-2
MMRRC Submission 042936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5357 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3917192-3932159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3926017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 137 (D137A)
Ref Sequence ENSEMBL: ENSMUSP00000105620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020710] [ENSMUST00000109988] [ENSMUST00000109989] [ENSMUST00000109990] [ENSMUST00000109991] [ENSMUST00000109992] [ENSMUST00000109993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020710
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020710
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109988
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105615
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109989
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105616
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109990
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105617
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109991
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105618
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 3 331 1.2e-118 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 429 9.3e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109992
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105619
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109993
AA Change: D137A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105620
Gene: ENSMUSG00000020432
AA Change: D137A

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: This locus controls transcobalamin-2 electrophoretic variation. The s allele determines a slow band in serum from A/J, C57BL/6, BALB/c and C3H/He; the f allele determines faster form in NZB, ST/b and CPB-WV. Heterozygotes have both forms. Sequencing reveals a Gly to Glu substitution in NZB compared to BALB/c, DBA/2 and C57BL/6 (Genbank AF090686). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,152 V206A possibly damaging Het
5730522E02Rik A T 11: 25,648,148 C102* probably null Het
Brsk2 C A 7: 141,984,511 D131E possibly damaging Het
Cacng7 T C 7: 3,338,936 F112L probably benign Het
Ceacam12 T A 7: 18,077,459 C282* probably null Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Dyrk1b T C 7: 28,185,318 V326A possibly damaging Het
Eloa T C 4: 136,009,248 D563G probably benign Het
Evi5l A G 8: 4,203,623 K489R possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Galntl6 T C 8: 57,884,463 E326G probably damaging Het
Gm1758 G A 16: 14,502,354 noncoding transcript Het
Grm8 A T 6: 27,762,419 L269Q probably damaging Het
Hsd17b12 A G 2: 94,033,645 I284T possibly damaging Het
Hyal6 T A 6: 24,734,518 M150K probably benign Het
Ift80 T A 3: 68,990,780 Q74L possibly damaging Het
Krt76 T C 15: 101,887,385 K450R probably benign Het
Larp1b A G 3: 41,024,515 E2G probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map2k7 A T 8: 4,244,461 H253L probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mmp2 A G 8: 92,833,152 T248A possibly damaging Het
Mt1 T A 8: 94,180,104 C33S probably damaging Het
Obox5 T A 7: 15,757,538 M1K probably null Het
Pak4 A G 7: 28,564,406 S302P probably damaging Het
Pcsk2 T C 2: 143,573,464 Y66H probably benign Het
Pgm3 G A 9: 86,556,257 R451* probably null Het
Phf10 A T 17: 14,954,013 probably null Het
Pkd1 T G 17: 24,565,790 V402G probably damaging Het
Plekha4 G T 7: 45,534,771 V61F probably damaging Het
Ppfia2 G A 10: 106,904,847 probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Skil A G 3: 31,113,551 H444R probably benign Het
Tnks2 G A 19: 36,849,290 silent Het
Trh T A 6: 92,242,834 D167V probably benign Het
Tshz1 C T 18: 84,015,080 G401D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl T A 7: 104,148,931 Q453L probably damaging Het
Vmn2r111 T A 17: 22,548,102 K805* probably null Het
Wnt16 T G 6: 22,291,232 probably benign Het
Zc3h11a A T 1: 133,623,042 V665E probably damaging Het
Zfp456 A T 13: 67,372,209 M63K possibly damaging Het
Zzef1 C T 11: 72,843,333 Q584* probably null Het
Other mutations in Tcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Tcn2 APN 11 3925072 missense probably benign
IGL02311:Tcn2 APN 11 3917692 missense probably damaging 1.00
IGL02614:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02655:Tcn2 APN 11 3926158 missense possibly damaging 0.91
IGL02679:Tcn2 APN 11 3927504 missense possibly damaging 0.93
IGL02752:Tcn2 APN 11 3926158 missense possibly damaging 0.91
R0265:Tcn2 UTSW 11 3922044 missense probably damaging 1.00
R0845:Tcn2 UTSW 11 3919349 missense probably benign
R1255:Tcn2 UTSW 11 3922120 missense probably benign 0.16
R1459:Tcn2 UTSW 11 3927516 missense probably benign 0.01
R1696:Tcn2 UTSW 11 3922169 missense probably damaging 1.00
R4209:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4210:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R4211:Tcn2 UTSW 11 3922114 missense possibly damaging 0.91
R5973:Tcn2 UTSW 11 3927546 nonsense probably null
R6973:Tcn2 UTSW 11 3917649 makesense probably null
R7479:Tcn2 UTSW 11 3917703 missense probably damaging 1.00
R8023:Tcn2 UTSW 11 3927579 missense possibly damaging 0.95
T0975:Tcn2 UTSW 11 3923487 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTTCTAGGTAGACCCAGTGAGG -3'
(R):5'- AGGGGAGCACCTTCTTACAAAG -3'

Sequencing Primer
(F):5'- TTAGAAGAGGTCTGGGAAGAAACC -3'
(R):5'- ACAAAGGTTCTCTTGTCTTGCC -3'
Posted On2016-10-06