Incidental Mutation 'R5357:Zfp456'
ID434557
Institutional Source Beutler Lab
Gene Symbol Zfp456
Ensembl Gene ENSMUSG00000078995
Gene Namezinc finger protein 456
SynonymsRslcan-13
MMRRC Submission 042936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5357 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67362113-67375810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67372209 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 63 (M63K)
Ref Sequence ENSEMBL: ENSMUSP00000130928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057070] [ENSMUST00000166080] [ENSMUST00000172266] [ENSMUST00000225787]
Predicted Effect probably benign
Transcript: ENSMUST00000057070
AA Change: M63K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059686
Gene: ENSMUSG00000078995
AA Change: M63K

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
ZnF_C2H2 106 128 1.92e-2 SMART
ZnF_C2H2 134 156 5.77e0 SMART
ZnF_C2H2 162 184 1.28e-3 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 246 268 2.17e-1 SMART
ZnF_C2H2 274 296 7.37e-4 SMART
ZnF_C2H2 302 324 6.32e-3 SMART
ZnF_C2H2 330 352 2.4e-3 SMART
ZnF_C2H2 358 380 8.94e-3 SMART
ZnF_C2H2 386 408 1.92e-2 SMART
ZnF_C2H2 414 436 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166080
AA Change: M63K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692
AA Change: M63K

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172266
AA Change: M63K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130928
Gene: ENSMUSG00000078995
AA Change: M63K

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225787
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.4%
  • 10x: 94.5%
  • 20x: 87.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik T C 4: 137,455,152 V206A possibly damaging Het
5730522E02Rik A T 11: 25,648,148 C102* probably null Het
Brsk2 C A 7: 141,984,511 D131E possibly damaging Het
Cacng7 T C 7: 3,338,936 F112L probably benign Het
Ceacam12 T A 7: 18,077,459 C282* probably null Het
Dnm1 T C 2: 32,336,241 D312G probably null Het
Dyrk1b T C 7: 28,185,318 V326A possibly damaging Het
Eloa T C 4: 136,009,248 D563G probably benign Het
Evi5l A G 8: 4,203,623 K489R possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Galntl6 T C 8: 57,884,463 E326G probably damaging Het
Gm1758 G A 16: 14,502,354 noncoding transcript Het
Grm8 A T 6: 27,762,419 L269Q probably damaging Het
Hsd17b12 A G 2: 94,033,645 I284T possibly damaging Het
Hyal6 T A 6: 24,734,518 M150K probably benign Het
Ift80 T A 3: 68,990,780 Q74L possibly damaging Het
Krt76 T C 15: 101,887,385 K450R probably benign Het
Larp1b A G 3: 41,024,515 E2G probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map2k7 A T 8: 4,244,461 H253L probably damaging Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mmp2 A G 8: 92,833,152 T248A possibly damaging Het
Mt1 T A 8: 94,180,104 C33S probably damaging Het
Obox5 T A 7: 15,757,538 M1K probably null Het
Pak4 A G 7: 28,564,406 S302P probably damaging Het
Pcsk2 T C 2: 143,573,464 Y66H probably benign Het
Pgm3 G A 9: 86,556,257 R451* probably null Het
Phf10 A T 17: 14,954,013 probably null Het
Pkd1 T G 17: 24,565,790 V402G probably damaging Het
Plekha4 G T 7: 45,534,771 V61F probably damaging Het
Ppfia2 G A 10: 106,904,847 probably null Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Skil A G 3: 31,113,551 H444R probably benign Het
Tcn2 T G 11: 3,926,017 D137A possibly damaging Het
Tnks2 G A 19: 36,849,290 silent Het
Trh T A 6: 92,242,834 D167V probably benign Het
Tshz1 C T 18: 84,015,080 G401D probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl T A 7: 104,148,931 Q453L probably damaging Het
Vmn2r111 T A 17: 22,548,102 K805* probably null Het
Wnt16 T G 6: 22,291,232 probably benign Het
Zc3h11a A T 1: 133,623,042 V665E probably damaging Het
Zzef1 C T 11: 72,843,333 Q584* probably null Het
Other mutations in Zfp456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Zfp456 APN 13 67367153 missense probably benign 0.06
IGL03200:Zfp456 APN 13 67366477 missense probably benign
IGL03406:Zfp456 APN 13 67366331 missense probably damaging 0.98
R0667:Zfp456 UTSW 13 67366742 missense probably benign 0.00
R0729:Zfp456 UTSW 13 67366544 missense probably damaging 1.00
R1731:Zfp456 UTSW 13 67366555 missense probably benign 0.39
R1832:Zfp456 UTSW 13 67367363 missense probably benign 0.09
R2011:Zfp456 UTSW 13 67366874 nonsense probably null
R2022:Zfp456 UTSW 13 67366497 nonsense probably null
R2023:Zfp456 UTSW 13 67366497 nonsense probably null
R2438:Zfp456 UTSW 13 67366954 missense probably damaging 1.00
R2516:Zfp456 UTSW 13 67362372 missense probably benign 0.00
R2896:Zfp456 UTSW 13 67367297 missense possibly damaging 0.52
R3964:Zfp456 UTSW 13 67366781 missense probably benign 0.03
R4930:Zfp456 UTSW 13 67366946 missense probably benign
R4971:Zfp456 UTSW 13 67366876 missense probably benign 0.31
R5754:Zfp456 UTSW 13 67366240 missense probably benign 0.40
R5795:Zfp456 UTSW 13 67366920 missense probably benign
R6339:Zfp456 UTSW 13 67362364 nonsense probably null
R6904:Zfp456 UTSW 13 67366265 missense probably benign 0.44
R7071:Zfp456 UTSW 13 67372777 missense probably damaging 1.00
R7690:Zfp456 UTSW 13 67366794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAATACATGCACAGGGC -3'
(R):5'- CCCTTGAAGGAACTAATTGTCTGC -3'

Sequencing Primer
(F):5'- ACAGGGCACACTGTTTGC -3'
(R):5'- CTCTTGTTCTCCAAACAGGT -3'
Posted On2016-10-06